A solution has a pH of 5.4. What is its pOH O5.4 8.6
Q: Concentration Substrate/Cofactor (nM)
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: 6. Describe the salient features and functions of phospholipids
A: Phospholipids or phosphatides are molecules which belong to the class of lipids has hydrophilic…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Sorbitol is a carbohydrate that is classified as a sugar alcohol or polyol.
Q: The steps of glycolysis between glyceraldehyde 3-phosphate and 3-phosphoglycerate do NOT involve:…
A: Glycolysis is defined as the process of breaking down the compound called "glucose" to create…
Q: Which of the following is the process where there is transfer of phosphate group to produce ATP or…
A: ATP and GTP are nucleoside triphosphates that are important for cellular function. They are produced…
Q: 7. What are the current treatments for PK deficiency patients?
A: Pyruvate kinase deficiency is a genetic inability to make the enzyme pyruvate kinase, which is…
Q: Calculate the standard free-energy change, deltaG'o, for the reaction in which acetaldehyde is…
A: NADH is used as the biological electron carrier and is used for the reduction of Acetaldehyde in…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: Consider this intermediate in the derivation of the Michaelis-Menten equation. [E] [S] k-1 + k2 [ES|…
A: Km : The concentration of substrate at which enzyme achieves half Vmax-maximum velocity
Q: A physician diagnoses an infant patient with a pyruvate carboxylase deficiency in part by measuring…
A: In case of Pyruvate Carboxylase deficiency, body accumulates lactic acid in blood. This is an…
Q: Describe the process of DNA replication, including the enzymes involved (85%), and give two examples…
A: DNA replication is a process of duplication of genetic material during the process of cell division…
Q: pyruvate in the glycolytic pathway build up slowing the pathway. Which of the following products may…
A: RBCs carry oxygen from the lungs to the rest of the body's cells. This oxygen is needed to generate…
Q: Cyclic terpenes also contain links that are 1-1, 1-4, or 4-4 True O False
A: There are many types of aromatic compounds found in plants, but many people associate them with…
Q: What types of monomers make up a carbohydrate? What are carbohydrate polymers called?
A: Carbohydrates are biomolecules made up of carbon, hydrogen, and oxygen. The ratio of H and O is the…
Q: the structure of a soap molecule, use the concept of intermolecular forces to explain why we use…
A: Soap molecules has hydrophilic head and a hydrophobic tail, they are composed of long chains of…
Q: Time left 1:48 37 Please describe the digestion process of proteins in the whole digestive system.…
A: In process of digestion, complex molecules are converted to simple molecules with the…
Q: BACKGROUND A 2-year-old black girl is being seen by the hematologist after her pediatrician found…
A: Due to the lack of mitochondria, there is no TCA cycle occurring in the RBCs. So, RBCs obtain the…
Q: HN- CH H2N-CH-c-OH HaN — сн—с— он | Н-N— сн—с—он CH2 CH2 ČH2 CH2 CH2 CH2 NH2 ÓH A B D H2N-CH-C. -ОН…
A: Aminoacids are the building blocks of proteins. They have two functional groups along with side…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: O dihydroxyacetone-P DHAP ATP ADP ATP ADP glucose-6-P G-6-P fructose-6-P F-6-P glucose…
A: In the diagram glycolytic pathway, pentose phosphate pathway and Leubering- Rapport shunt is given…
Q: sunganegy Two dialysis membranes each containing a methylene blue solution were placed in beakers of…
A: In dialysis, colloids are separated from dissolved ions or molecules of small dimensions or…
Q: जन्का ली देकर परार देेल लब्पsogene sn जाक ? A) Hn iso2gme cam be Coeed 0Siलह कसक्ट कर Te १riance…
A: Enzymes are the protein molecules that increase the rate of reactions by decreasing the activation…
Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…
A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…
Q: Why some of the dissolved plant matter travels faster with the alcohol up the filter paper than the…
A: Answer: Ethanol has high eluting nature, and also has higher viscosity through which it can travel…
Q: What are the current treatments for Pyruvate Kinase Deficiency (PKD) patients?
A: Pyruvate kinase deficiency is a genetic disorder in which the enzyme pyruvate kinase, which is…
Q: Can I have help with number 2 and 3? 2) 2What is the specific function of the enzyme catalase? 3)…
A: Partial reduction of oxygen in the electron transport chain and peroxidation of lipids cause the…
Q: Which of the following statements is correct about oxidative pentose phosphate pathway? Group of…
A: Oxidative pentose phosphate pathway: . This is the first phase in pentose phosphate pathway in which…
Q: please name and characterize the enzym class according to the given rraction CH CH,OH ion HO-C-H…
A: In the given reaction fructose-1,6-bisphosphate is broken into two three-carbon molecules. The…
Q: what transport proteins are involved is getting ca2+ out of cytosol
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: 4. Enzymes in an enzymatic reaction do not interfere with: a. free energy of reaction b. rate of…
A: Enzymes are the biological catalysts that speed up the rate of reaction by lowering the activation…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Retroviruses are viruses with an enzyme known as reverse transcriptase. Transcription is the process…
Q: What is the significance of the positioning of the amino acid side chains and alpha carbons as you…
A: Proteins are polymers of amino acids linked by peptide bond/amide bond. Peptide bond is a covalent,…
Q: Draw a Lineweaver-Burk plot for these data. Put both sets of data on the one graph, use a different…
A: If an enzyme follows Michaelis-Menten Kinetics, a plot of the reciprocal of the reaction velocity…
Q: 2. Which enzyme is used in the estimation of glucose from the blood sample using biosensors? a.…
A: Biosensors are device used that calculates measurable signal for a particular test. Pregnancy tests…
Q: (continued) B. From a metabolic engineering perspective, why did the researchers heterologously…
A: Zymomonas mobilis is a gram negative facultative anaerobic bacteria. It ferments the pyruvate into…
Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…
A: Pyruvate kinase is an glycolytic enzyme, which catalyzes the conversion of phosphoenolpyruvate (PEP)…
Q: Progesterone is mainly responsible for the development of sexual characteristics and function O True…
A: Progesterone is a C-21 steroid hormone. Cholesterol is the precursor for progesterone. Progesterone…
Q: What 3 antibiotics that are active against G= and G- organisms contain both proteinogenic and…
A: Hi, thanks a lot for submitting the question. Here question have typo error and G= is G+ I believe…
Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…
A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…
Q: 5. Regulation of bacterial operons by inducers, e.g. lactose, exhibits which of the following…
A: The regulation of gene expression can occur at the level of transcription and translation.
Q: In Metabolic Pathways, what are the nucleotide-containing compounds?
A: A nucleotide mainly consists of a sugar molecule that is either ribose in RNA or deoxyribose in DNA…
Q: Which statement best describes the Cori cycle? Group of answer choices It regenerates glucose from…
A: Cori cycle: This is the metabolic pathway in which lactate produced during anaerobic glycolysis is…
Q: With basic knowledge and understanding in biochemical energy production now, recall your last meal,…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: What molecule provides the energy for fatty acid synthesis starting from acetyl-CoA and malonyl-CoA…
A: Fatty acid synthesis is a building up of long chains of fatty acids from 2 carbon units called…
Q: In the isolation of metabolites and tests for phytochemicals, why should people dry the leaves in…
A: Phytochemicals are compounds that are produced mostly by plants and have biological activity. Plants…
Q: What are the control mechanisms of glycolysis and the Krebs cycle.
A: The question is all about the process involve in respiration like glycolysis and kreb cycle in which…
Q: Beginning an endurance training programme can increase body weight because in the first few days of…
A: As of now days we can see the obesity is major concern infornt of people , increase weight of people…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- H2SO4 is 0,5 mol What is the pH of this solution? What is the pH of 35 ml buffer solution which is 0,3 M in CH3COOH and 0,5 M in CH3COONA ? 7. The pH of buffer solution is 7.0. What is the hydronium-ion conor10 mL of 0.5 M CuSO₄ * 5H₂O solution from 10 M CuSO₄ * 5H₂O solutionWhat is the approximate pH of a solution labeled 6 x 10-5 M HBr? * 4.2 4.5 5.8 9.8 8.2
- At pH 10, [OH-] is— 10 M 5 M 10-10 M 10-4 M 0.0000001 MA volumetric flask is made to prepare a certain chemical concentration through dilution for example if there is no volumetric flasks how can you prepare 0.2N or acetic acid from 1 N acetic acid stock solution.what is the pH of a solution with a H+ concentration of 1.44 x 10-3 M
- Tomato juice has a OH- concentration equal to 1 X 10 -10, what is the pH of this solution?Estimate the pH of a 7.18 x 106 M HF solution. You can calculate the lowest possible pH, knowing that the actual value will be higher. Your answer should contain 3 decimal places as this corresponds to 3 significant figures when dealing with logs. pH will be above Select the solution with the highest pH. Multiple Choice 0.0225 MLIOH 0.0225 MH2CO3 0.0225 MCH3NH2Describe how you would prepare a 500 ml of 0.35M Glycine pH2.2 from a 5M Glycine solution of pH 7. Show your calculations.