8. Which of the following gene mutations is most likely to affect correct protein production? The boxes are the exons and the lines are the introns in the gene a. b. Site 1 Site 2 Explain WHY. Site 3 a two base-pair deletion at Site 1 that removes two "G-C" nucleotide pairs from the gene sequence a single base-pair substitution at Site 2 that changes a tyrosine-encoding amino acid (TAC) to a stop codon (TAA) C. a single base-pair substitution at Site 3 that changes one alanine-encoding codon (GCC) to another (GCA) d. a single base-pair insertion at Site 4 that shifts the reading frame for subsequent codons Site 4
Q: During exercise in a hot and humid environment, the inability of the body to lose excess heat…
A: Exercise in hot and humid environments poses challenges to the body's ability to dissipate excess…
Q: Please fill in the table with the type of pathogen and the genus species for each of the following…
A: Pathogen It refers to organisms like fungi, bacteria, or viruses that are responsible for causing…
Q: On the back of the human skull, there is a small bump, below which is an opening where the spinal…
A: Homo, a genus of the family Hominidae characterized by a relatively large cranial capacity, limb…
Q: Question 36 After several years of trying to have children, Jack and Diane decide to have a child by…
A: FSH acts on the granulosa cells within the ovarian follicles, stimulating them to proliferate and…
Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…
A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…
Q: please help me with this question. As this is a non-directional cloning, recombinant plasmids can…
A: In order to create DNA fragments with specified complementary end sequences which can be linked…
Q: Create a research hypothesis using the statement if the problem: Statement of the Problem This…
A: Mendelian Genetics is a fundamental concept in biology that explains how traits are inherited from…
Q: List 5 similarities and differences between oxidative phosphorylation and light reactions in the…
A: In the process of oxidative phosphorylation, oxygen is consumed as electrons are transported along…
Q: The question mentioned structural formulas. How does this reaction look in that format?
A: The activation and oxidation of a 7-carbon fatty acid within the liver contain several steps and…
Q: The evolutionary history of a species or group of species is known as its ____________________ and…
A: The term "species" refers to the fundamental unit of biological classification in the field of…
Q: Scenario 1: You are running a marathon and observe that running increases your pulse rate. Using…
A: In this experiment, Sarah conducted a series of kicks using both fully inflated and partially…
Q: 1. Suppose that rabbits are the only prey and food supply of foxes, and that the predator-prey…
A: The Lotka-Volterra equations are a pair of differential equations that model the dynamics of…
Q: Which of the following is a characteristic of all chordates at some point during their life cycle?…
A: Kingdom Animalia includes the phylum Chordata. The phylum Chordata is further divided into three…
Q: Which of the following are needed for successful DNA replication? Selected answer will be…
A: The replication of DNA is the technique through which DNA duplicates itself during cell division.…
Q: explain the composition, process, and parts of an air gap membrane distillation
A: There are a few important points about membrane distillation. With the help of membrane…
Q: EXPLAIN how a SINGLE gene can make different proteins in different cells.
A: The Central Dogma states that DNA is transcribed into RNA, which is then translated into proteins.…
Q: This karyotype is from a baby that was born alive but died shortly after birth. What condition is…
A: A normal human cell has diploid (2n) sets of chromosomes. That means each set of chromosomes has 2…
Q: Write down two external and two internal factors that interfere with your ability to hear clearly.
A: external factors that interfere with your ability to hear clearly are:- 1. Ambient noise: Loud…
Q: In a discussion about the origin of life, one student argued that RNA molecules must have come…
A: RNA and DNA are both nucleic acids that play crucial roles in the storage and transmission of…
Q: Making cDNA from mRNA requires an enzyme called ____________________
A: Complementary DNA (cDNA) is created in molecular biology using an RNA template in a process that is…
Q: You will need to complete this question on a separate piece of paper. Scan or take a picture of it…
A: Logistic growth is the growth in population size with time and levels off when reaching a maximum…
Q: As you record your description in the table label the part on the diagram on the back of this page.…
A: Understanding an organism's organ system is essential to understanding its general physiology and…
Q: Two different strains of the same bacteria grow on minimal media. What would be the outcome of…
A: The many microbial species exhibit a wide range of activities. One of the bacterial groupings is…
Q: 21. Which of the following is an example of an indirect survey? A student records observations of…
A: An indirect survey is a method of data collection in which information is gathered without direct…
Q: Several DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed…
A: The given experimental setup involves the expression of various proteins and treatments using siRNAs…
Q: 2. Shown below is a schematic of a prokaryotic gene. The light dotted area represents the region…
A: Promoter region on the DNA represents the region where RNA polymerase binds to the DNA to start off…
Q: Describe the structure and function of the brain, nervous system, limbic system, and the…
A: The central nervous system (CNS) is a complex and vital network responsible for processing…
Q: Describe the function of the retina
A: The retina is a layer of tissue at the back of the eye that is responsible for converting light into…
Q: Let's go back to the image from the "Think About It." Use your new vocabulary, evidence from the…
A: Asexual reproduction is defined as type of reproduction wherein a new offspring is produced through…
Q: Create a table about the morphology of Tamarindus indica
A: Plant kingdom is one of five kingdom which includes green, photosynthetic organisms. It includes :-…
Q: Give typing answer with explanation and conclusion How will a mutation in step 6 of glycolysis…
A: If a mutation occurs in step 6 of glycolysis which involves the enzyme glyceraldehyde-3-phosphate…
Q: Which of the following statements best describes Starling's hypothesis (Starling Equation, not the…
A: Starting equation is governed by Starling forces that are the physical forces which determine the…
Q: A. The idea associated with the belief that all species could be arranged from primitive to…
A: Evolution is the process through which living organisms change over time and give rise to new…
Q: 3. The human genome contains about 20,000 genes but human cells can synthesize about 80,000…
A: The human genome is made up of both coding and non-coding regions. The coding regions, also known as…
Q: Compare and contrast "maternal effect", "maternal inheritance", "parental imprinting"
A: Answer : Maternal inheritance is the phenomenon which appears in the childrens in which they get the…
Q: You generate mutants in the metabolic pathway for starlase. You conduct some complementation ests…
A: In genetics, if two different genetic mutations occur in separate genes in a single organism, they…
Q: You are examining the fossil record and notice a dramatic decrease in species diversity that seems…
A: A fossil is defined as the preserved remains or impression of animals or plants from a past…
Q: 4. Enzymes: Remember enzymes have two jobs: they lower activation energy and speed up reactions. a.…
A: Firstly, understanding enzymes like amylase is pivotal. These biological catalysts have specific…
Q: Tissue 1 Tissue Identification Tissue Name: Class (There are classes of tissues): Function and…
A: Adipose tissues have little matrix; closely packed adipocytes and have nucleus that is pushed to the…
Q: om the simplest vertebrate to the most advanced? 2) What do those advancements allow? The most…
A: The heart is the hub of the circulatory system, and its main function is to pump blood through the…
Q: Angiotensin Converting Enzyme (ACE) is produced by endothelial cells throughout the body, but the…
A: ACE is angiotensin converting enzyme, it is the cental component of the renin- angiotensin system.…
Q: What is the difference between sticky/cohesive ends and blunt ends as products of digestion?
A: Restriction enzymes are defined as the enzymes synthesized by certain bacteria with the property of…
Q: Looking at Fig. 3a and 3b, how do you know that 3a has a significant difference and that Fig. 3b…
A: Hashimoto thyroiditis is a medical term used to describe a medical condition where the immune cells…
Q: Question 34 Which of the following hormones is synthesized from a cholesterol precursor? O A.…
A: The question concerns the biosynthesis of various hormones and specifically asks which of the given…
Q: Briefly discuss how Enzyme-linked immunosorbent assay (ELISA) and western blotting contribute to…
A: Immunological testing is a set of laboratory techniques and procedures used to assess and analyse…
Q: Cape parrots are found in forests in South Africa. In a study of Cape parrot genetics, biologists…
A: Cells of an individual species that participate in the process of reproduction are known as gametes.…
Q: Regarding modern Homo sapiens' origins, which of the following theories most closely matches this…
A: The process of change in the hereditary traits of biological populations over subsequent…
Q: A. The earliest evolutionary change in the hominins was a. increased brain size. b. habitual…
A: Evolution is defined as the process by which the an organism change through time as a result of…
Q: Explain the results in detail for population growth of E.coli at various temperatures at different…
A: The lower intestine of warm-blooded species frequently holds the bacterium Escherichia coli. It is a…
Q: Inbreeding by Chromosome BETA We analyzed the areas of inbreeding across your dog's genome. Below is…
A: Inbred dogs result due to the inbreeding of related individuals where as outbreeding of dogs result…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Table of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…1. Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds from left to right. 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGACCTAAGC -3' 56 1 11 + ---+--- ----+-- * a. Draw a green box around the promoter. b. Label the template strand of the DNA on the sequence above. C. Write the sequence of the mRNA. Anticodon sequence: --+--- 3'-GGCTATATTACTCAGCAGCAGACCCGGAAGTACATAAGTACCCTTCTCTGGATTCG ---+-- -5' d. Write the sequence of the peptide that is translated from the mature mRNA and label the directionality of the peptide. e. Give the sequence (and indicate the directionality) of the anti-codon on the tRNA that inserts the 2nd amino acid into the newly made peptide. f. Imagine that, in the process of DNA replication, the 39th base in the gene (with the *) was changed from A/T to C/G. What would be the effect of this mutation on the produced peptide?6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
- 1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?45. A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their replacement by two new bases. The deletion is shown below. AAG ↻Deleted bases The deleted bases are replaced by two guanine bases.The transcription of the mutated Duchenne muscular dystrophy gene described above results in the replacement of a Select one: a. lysine codon with a serine codon b. phenylalanine codon with a serine codon c. phenylalanine codon with an arginine codon d. lysine codon with an arginine codon1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
- 1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA1. The following is the partial DNA sequence of Gene A. Note: The underlined sequence (from position 20-54) represents the promoter for Gene A and the underlined and italicized sequence (from position 71-90 represents the ribosome binding (RBS) site of Gene A. Transcription begins at and includes the bold T/A base pair at position 60. 10 20 30 40 50 60 70 --- 5 ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3 TAGCCAGAGCCGATGATGTATTTG TATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 --- 5' СAGGTAТCGGTCTGATСТАССТАGСттстсттстстстстсССССGCGGGGGCTGTACTATCАTGCGTCG 3 GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 --I- - -I- -- 5 TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3 AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT What are the first 4 amino acids encoded by Gene A? Write the N and C terminal ends. Hint: Find the DNA coding strand,…
- 1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)1. Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous end-joining b. Nucleotide excision repair c. Mismatch repair d. Homologous recombination 2. In eukaryotes, what must be formed before translation is initiated? a. The binding of 30s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf b. The binding of 40s ribosomes with eIF1, eIF3, mRNA, and fmet-tRNAf c. The binding of 50s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf d. The circularization of mRNA and subsequent binding with the complex made up of 40s ribosomes with eIF1, eIF3, and met-tRNAi. 3. Which of the following eukaryotic transcription initiation factors is correctly paired with their function? a. TFIID recruits RNAPII to the promoter b. TFIIA binds to the TATA box. c. TFIIF kicks out the inhibitory protein in TFIID. d. TFIIH melts the DNA to open the transcription bubble.29. pre-MRNA transcript 5' 3' Open boxes represent introns Filled boxes represent exons A) Draw the MRNA to be translated if the pre-mRNA is constitutively spliced. S B) Draw an mRNA to be translated if the pre-MRNA is alternatively spliced due to exon skipping.