5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'
Q: pls help ASAP, thanks!
A: In the anaplerotic reaction the oxaloacetate metabolite is converted to PEP by the PEP carboxykinase…
Q: Each of the following enzymes are similar in that they are all regulation points for the…
A: Enzymes are chemical substances that function in several biochemical reactions and help in the…
Q: During plasmid extraction, after the addition of acetate-conta in ing neutralization buffer the…
A: Plasmids are extrachromosomal DNA in the bacterial cells. They are double stranded circular DNA,…
Q: If a base, such as sodium hydroxide (NaOH) were added to milk, would the protein precipitate? Why or…
A: Milk is a great source of vitamins and minerals, especially calcium. Milk plays a crucial role in…
Q: Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein…
A: Ribosomes are present in prokaryotes as well as eukaryotes. mammalian…
Q: 10 b. How many different proteins composed of 100 amino acids could possibly exist?
A: The building blocks for the synthesis of proteins are amino acids. 20 different amino acids…
Q: ______ 1. is the enzyme classification where lysozyme belongs ______ 2. is the name of the enzyme…
A: Note : Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Base your answers on the choices below: Specific Analyte for Test Mechanism of Test Positive Result…
A: The qualitative tests are used to detect the presence or absence of a substance. Different…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
Q: 2. Phenothiazine derivatives (chlorpromazine, propazine, triftazine, etc.). Relationship between…
A: Phenothiazines are neuroleptic sellers that affect a selection of receptors along with dopaminergic…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: during digestion the pH in the stomach is 2. what does this indicate about the optimum pH of pepsin…
A: Digestion is the process of conversion of complex food substances into simple absorbable forms. The…
Q: List a physiological emulsifying agent produced in the liver. What role does this substance play in…
A: Hepatocytes produce bile, which would then be altered by the cholangiocytes that line the bile…
Q: What forces contribute to the folding of a polypeptide? Can you explain the reasoning too?
A: The folding of a protein into its proper three dimensional structure is necessary for attaining the…
Q: In terms of structure, what is the commonality between aldolase (glycolyssis) and transaldolase…
A: Aldolase is an enzyme that is involved in glycolysis and it converts fructose-1,6-bisphosphate into…
Q: С 17 Based on the knowledge you gained from the cloning module, which of the bands in the figure is…
A: Agarose gel electrophoresis is a method used in molecular biology to resolve DNA fragments on the…
Q: Long explanations are not needed. True or False a. One NADH is produced for every pyruvate…
A: The pentose phosphate pathway is an alternative pathway for glucose oxidation. It provides NADPH for…
Q: Given the knowledge of biochemistry, make a sample outline of a new 24-hour healthy meal. Provide…
A: The human body can be viewed as an engine that releases the energy contained in the foods it…
Q: Based on the given picture, answer numbers 1-3. Also, answer number 4. 1. What are the two…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, please repost…
Q: What are the different sections in the Clinical laboratory? Which one you think, will be your…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: 3. One indication of the relative importance of various ATP-producing pathways is the Vmax of…
A: Pheasant pectoral muscles are clearly anaerobic, as expected from a bird highly trained for…
Q: How many enyzymatic reactions are there in glycolysis pathway?
A: There are 10 enzymatic reactions in glycolysis pathway.
Q: What are Okazaki fragments? Why are they formed?
A: DNA replication is the process by which double-stranded DNA is copied to produce two identical…
Q: tफकाटक ननी वकट नवींणणणणय हैमकजनाययळे प्B fAtzeorgating a) it is mare highly hydrated. are pressture…
A: The hydrophobic interaction is critical for the stability of several bioactive systems and plays a…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: explain Role of telomere in disease give a diagram
A: A telomere is a region at the ends of linear chromosomes that contains repeating nucleotide…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Currently available INSULIN PRODUCTS/MEDICATIONS in the market: Brand Name Route Onset (min.)…
A:
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: Why is the formation of a peptide bond called a condensation reaction? Explain briefly
A:
Q: Explain the Role of telomere in regards to cancer
A: Telomeres gradually shorten with each cell division, resulting in less protection for the…
Q: Why should starch solution be freshly prepared
A: Starch, also known as amylum, is a polymeric carbohydrate made up of several glucose units linked…
Q: What is the purpose of adding the dishwashing liquid to the DNA extraction?
A: DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular…
Q: 1. The best description of how muscles move is: spinning basal bodies sliding filaments adding…
A: Muscles contract and then relax to move bodily components. Muscles can move bones, but they didn't…
Q: do non reducing sugars have reactive anomeric carbon?
A: Introduction: Carbohydrates are polyhydroxy aldehydes or ketones with a molecular formula of CnH2On.…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which is NOT a difference between RNA and DNA? Select one: A. RNA contains uracil; DNA usually…
A: Introduction: Nucleic acids are molecules that store hereditary information for cellular growth and…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: Use the data below to determine the maximum velocity [in mM/s] of a certain enzyme-catalyzed…
A: We must know the Michaelis Menten equation: V=Vmax [S]Km+ [S]
Q: 4. During a lunch at a McDonald's outlet, an officc employce reccived about 350 g of carbohydrates…
A: The absorptive state, or the fed state, occurs after a meal. In this state the body is in the…
Q: Fibrous proteins, globular proteins, and conjugated proteins are the three (3) primary kinds of…
A: Proteins which are most essential part of diet they are building block of body . Protein named by…
Q: Which of the following is NOT a non-carbohydrate material in gluconeogenesis? Choices: Lactate…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: acetate buffer works on fumarase activity but tris-maleate buffer does not
A: Fumarase is an enzyme that catalyzes reversible conversion of fumarase to malate in TCA cycle.…
Q: immunoglobulins. Immunoglobulin Function/s Ig A Ig D Ig E Ig G Ig M
A: Immunoglobulins, a specialised group of proteins that are mostly associated with gamma-globulin…
Q: for GABA transaminase, ornithine decarboxylase, and alanine
A: PLP-dependent enzymes catalyse a wide range of reactions that result in bond cleavage at the carbons…
Q: Which of the following best describes the mechanism of action of a cardiac glycoside? A)…
A: Cardiac glycosides are the compounds that are important for enhancing the force of heart to increase…
Q: Which of the following components are found in lipoproteins? Choose all that apply a. DNA b.…
A: Lipoproteins are essential components of the body that transport nutrients around. Lipoproteins are…
Step by step
Solved in 2 steps with 1 images
- DNA double helix does not have which of the following? antiparallel configuration complementary base pairing major and minor grooves uracilUsing Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.Which of the following does the enzyme primase synthesize? DNA primer RNA primer Okazaki fragments phosphodiester linkage
- 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' There are two introns in this DNA sequence. Remember introns start with GT and end with AG. (a) How many base pairs are in intron 1 and intron 2.If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNA
- 5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
- 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C34. Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing should be flat; do not draw the twist of the helix. Be sure to include the 5’-P, 3’- OH, deoxyribose sugar rings (with carbons 1’-5’ and the O indicated), and a simplified phosphodiester bond (O-P-O). Show purines as two differently-sized rings and pyrimidines as one ring and show the correct number of hydrogen bonds between bases. The dsDNA must be antiparallel. Drawing a simplified version of dsDNA will help you gain a better understanding of the concepts underlying dsDNA structure. It will most likely take a couple of tries to get a clear figure.wol for Frayon Elolog - Meet - cha-gX-m sc Jupiter Ed G Which orgerell= A sample of DNA is collected from an organism. It is analyzed and determined that 20% of the DNA is made up of the base adenine. Based on this information, which of the following correctly lists the amounts of the three. remaining bases for this sample? 10% cytosine, 30% thymine, 40% guanine O 20% cytosine, 20% thymine, 20% guanine 30% cytosine, 30% thymine, 20% guanine 30% cytosine, 20% thymine, 30% guanine p. 5 of 31