20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence and pro- duction. For "MRNA sequence" and "protein sequence", I am asking if the structure of these molecules (i.e., their sequence) changes. For "# of mRNA molecules" or "# of protein molecules", I am asking of the expression of these genes (i.e., how much mRNA or protein will be made) changes. It doesn't matter if the protein or DNA works or not. Assume each mutation is homozygous. # of mRNA protein # of protein protein molecules mRNA sequence molecules sequence function (best guess!) a mutation in promoter that leads to stronger binding of RNA polymerase a mutation in silencer that leads to weaker binding of repressor transcription factor a mutation in enhancer that leads to weaker binding of acti- vator transcription factor

20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence and pro- duction. For "MRNA sequence" and "protein sequence", I am asking if the structure of these molecules (i.e., their sequence) changes. For "# of mRNA molecules" or "# of protein molecules", I am asking of the expression of these genes (i.e., how much mRNA or protein will be made) changes. It doesn't matter if the protein or DNA works or not. Assume each mutation is homozygous. # of mRNA protein # of protein protein molecules mRNA sequence molecules sequence function (best guess!) a mutation in promoter that leads to stronger binding of RNA polymerase a mutation in silencer that leads to weaker binding of repressor transcription factor a mutation in enhancer that leads to weaker binding of acti- vator transcription factor

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

1. Determine what is being meant by each statements: a. It describes mRNA that results in a single translation of several genes at a time. b. This guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand.
10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables antisense oligonucleotides to block protein synthesis? O Antisense oligonucleotides bind to ribosomes and inhibit their function. Antisense oligonucleotides bind to DNA in the nucleus and inhibit the synthesis o MRNA. Antisense oligonucleotides bind to ribosomal RNA (rRNA) and inhibit ribosome assembly. Antisense oligonucleotides bind to messenger RNA (MRNA) and prevents mRNA binding to ribosomes.
1. Identify the term being asked by the statement: a. It describes mRNA that results in a single translation of several genes at a time. b. It guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. These are Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand. d. It is a A secondary structure in proteins where the amino acid chains aligned side-by-side with every other chain situated opposite the other, with chains being held together by hydrogen bonds
1. What mRNA sequence does the following DNA template sequence produce? DNA 3'-TAC mRNA: 5¹- GTATAATTGACATTTGATCTTATGACT-5' Write out the one letter code for this peptide then produced by this mRNA upon translation: peptide: N- -3'
6. How many amino acids will the mRNA sequence "AUG GÁC CUG UCG UGA" produce? (LS1-1) * Second mRNA base G UUU Phe UUC UCU UAU UGU Tyr UAC Cys UCC Ser UCA UGC C Phe Gly (G) Leu UAA Stop UGA Stop A Glu (F) (L) UUA Leu UUG Ser Asp (E) (D) (S) Tyr (Y) UCG UAG Stop UGG Trp GUC Ala CUU (A) A CCU CAU CGU His CUC Leu CUA CC Pro ССА CAC CGC Arg CGA Cys (C) Val CAA Gln CAG G U (V) G Trp (W) CUG CCG CGG Arg (R) G U A C A C Leu AUU ACU AAU Asn AGU Ser AGC (L) Ser (S) C AUC Ile ACC AAC Thr Lys (K) UG A AUA Pro AGA Arg AGG ACA AAA Lys AAG Asn (N) (P) AUG Met or start ACG His Thr (H) (T) Gln GUU GCU GAU Asp GAÇ GGU (Q) lle Arg (R) (1) GUC Val GUA GCC Ala GCA GGC Gly GGA GAA Glu OGAG GUG GCG GGG O 1 3 4 First mRNA base (5' end of codon) - U A GUca Gbc AG Third mRNA base (3' end of codon)
1.Describe the journey of a protein, from its synthesis to its final destination 2. Explain the different stages of transcription and the role of the elements involved with the right terminology (template vs. non-transcribed strand, promoter, stop sequence, TATA box, general and specific transcription factors, RNA polymerase II, etc.); 3. Explain what the maturation (modifications) of pre-messenger RNA consists of and its role
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter
(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
7) The protein VEGF plays an important role in stimulating the formation of new blood vessels. In some circumstances, cancer cells will produce too much VEGF. The drug PTC299 is currently being researched as a potential anti-cancer drug. It works by binding to VEGF mRNA, stopping this mRNA from being read by the ribosome. Therefore, not as much VEGF protein is produced. (National Cancer Institute. nd. NCI Drug Dictionary. Retrieved from: https://www.cancer.gov/publications/dictionaries/cancer-drug/def/vegf-inhibitor-ptc299) a) If approved, what kind of cancer treatment would it be considered (radiotherapy, gene therapy. anti-angiogenesis)? b) Briefly explain why you think PTC299 fits the kind of cancer treatment you indicated in a). Use information from the text to support your answer. c) Would PTC299 be considered a traditional or a targeted therapy?
A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)
4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'