2. Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3'Write the amino acid sequencea. For the protein synthesized from this MRNA.b. When U substitutes for C.substituted by U5'-CCGAACGAUGGGCUAUCCCUAACCGUUU-- 3'c. When C is deleted.deleted5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3'd. What type of mutation is illustrated in c? 3. The Watson-Crick model pictures DNA as a spiral staircase with theas the handrails and theas the step.4. Which of the following single-stranded DNA molecules would be palindromic in the double-stranded state?(A-T-G-C-C-G-T-A, G-T-C-A-T-G-A-C, A-T-G-C-T-A-C-G, G-C-T-A-T-G-A-C)5. In the replication of a DNA molecule, two daughter molecules, S and T, are formed. The following basesequence is part of the "parent" strand in daughter molecule S: 5' TTCAGAG 3'. Indicate thecorresponding base sequence ina) The newly formed strand in daughter molecule T.b) The newly formed strand in daughter molecule S.c) The "parent" strand in daughter molecule T.

We'll answer the first question since the exact one is not specified. Please submit a new question…

Answered: 2. Given the mRNA for a protein:…

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 12SQ

See similar textbooks

Similar questions

2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence a. For the protein synthesized from this mRNA. b. When U substitutes for C. substituted by U 5-CCGAACGAUGGGCUAUCCCUAACCGUUU-- 3 c. When C is deleted. deleted 5-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' d. What type of mutation is illustrated in c?
1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5' GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC 3' 2. a. From 1b, draw the structure of the peptide.
1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
First Position (5'-end) U C A U UUU Phe UUC Phe UUA Leu UUG Leu G CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG* Met GUU Val GUC Val GUA Val GUG Val с UCU UCC UCA UCG Ser Second Position A CCU Pro CCC Pro CCA Pro CCG Pro ACU ACC Ser Ser Ser Thr Thr ACA Thr ACG Thr GCU GCC Ala Ala GCA Ala GCG Ala *AUG also serves as the principal initiation codon. G UAU Tyr UGU UAC Tyr UGC UAA Stop UGA UAG Stop UGG CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA AAG GAU Asp GAC Asp GAA Glu GAG Glu CGU Arg CGC Arg CGA Arg CGG Arg Lys AGA Lys AGG Cys Cys Stop Trp AGU Ser AGC Ser GGU GGC Arg Arg Gly Gly GGA Gly GGG Gly Third Position (3'-end) DOAG DOAG U C U C DOAG DOAG U C U C
11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Lys. a. Provide one possible mRNA sequence for this peptide segment. b. Provide the corresponding tRNA anticodon for each amino acid. c. Provide the template DNA sequence for that mRNA. Table 1: Table of codons for amino acids. 1st position (5' end) C 2 G 2nd position (middle) U Phe F Phe F Leu L Leu L Leu L Leu L Leu L Leu L lle 1 lle 1 lle 1 START/Me tM Val V Val V Val V Val V. C Ser S Ser S Ser S Ser S Pro P Pro P Pro P Pro P The T The T The T The T Ala A Ala A Ala A Ala A Tyr Y Tyr Y STOP STOP His Hi His H Gln Q Gin Q Asa N Asa N Lys K Lys K Asp D Asp D Glu E Glu E G Cys C CVS C STOP Trp W Arg R Arg R Arg R Arg R Ser S Ser S Arg R Arg R Gly, G Saly, G Gly G G Gly *START codon signals the initiation of a peptide chain. *STOP codons signal the end of a peptide chain. 3rd position (3' end) JUAG C DURG C SCAG DUAG C
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?
2. Given a DNA template molecule of 5' - ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence and then the polypeptide sequence, starting at the first start codon. mRNA: 5'- CCAU AUG UUA ACU AGU AGG UAG GAG CCA U - 3' Polypeptide: (N) Met-Leu - Thr - Ser - Arg (C)
1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.
Iv been marked with 3 wrong answers for this problem. please help me identify my mistake. I understand mrna initiates but when in order of trna and rrna im a bit confused...

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning