13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b. GGGGTTAGGAACC c. GGGGAATCCTTGG d. GGTTCCTAAGGCC е. АТCGCCTТАCGCC
Q: The base sequence on one strand of DNA is ATGTCTATA(i) Give the base sequence of its complementary…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA
A:
Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…
A: transcription is the process by which messenger rna is made from dna .
Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…
A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…
Q: Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What…
A: Gene expression is the process by which the instructions in our DNA are converted into a functional…
Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…
A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…
Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…
A: Living cells use a collection of rules called the genetic code to translate information found in…
Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…
A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…
Q: 3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use…
A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…
Q: What would be the sequence that the RNA polymerase synthese from the follwing DNA sequence? 5'…
A: Transcription: The process of formation of RNA from the DNA by action of DNA dependant RNA…
Q: 1. Determine what amino acid will be formed from the given DNA strand below:…
A: DNA strands are coiled with each other and form the DNA double helix. Each strand of DNA contains…
Q: 5’GCTATAAAGCGTATCGCGTCATA 3
A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5
Q: 2. Describe what is meant be the antiparallel arrangement of DNA.
A: The double helix model of DNA was the famous and most valuable discovery by Watson and Crick. This…
Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC
A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 11.Fill out the following table by adding the complementary RNA and DNA basses. NA NA А G C
A: Answer: Nucleic bases are the nitrogen containing compounds such as adenine , guanine , thymine ,…
Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…
A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…
Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…
A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…
Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…
A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…
Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…
A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA mRNA…
Q: 2. The sequence of bases in a segment of mRNA is UUUCAUAAG. Answer the following questions: a. What…
A: mRNA is the transcript that is produced during the process of transcription from DNA by the enzyme…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q:
A: Purines is equal to pyrimidines. So A=T C=G
Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…
A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…
Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…
A: The explanation for the wrong statement is given below.
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 2. DNA → AGA ACA TAA ATG CTC TTA ACA CTC ATC AGA CCA GCA CTC CGA TGA MRNA > tRNA → protein >
A: During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an…
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition
A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…
Q: 9. Explain why DNA fragments move through a gel at different rates. (A2)
A: A technique called gel electrophoresis is used to separate DNA fragments (or other macromolecules,…
Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA
A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…
Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…
A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…
Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…
A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…
Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…
A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…
Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Complete the complement strand of DNA by providing the correct base pairs. Template Strand:…
A: DNA: The DNA molecule of all known animals and many viruses contain genetic instructions in the…
Q: 9. a. Describe the experiment that determined DNA is the genetic material. b. Describe the…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…
Q: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this…
A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is a double helical structure…
Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…
A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…
Q: 39. Match the following functions to the letters in the picture 67'F The doyua of cell biology (The…
A: Answer
Q: 6. What are the sides of the DNA ladder made of? a. b.
A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: Translation is process in which proteins are synthesized.
Q: 23. The location of a specific gene on a chromosome is called? A. The gene position B. The gene…
A: Chromosomes are rod-like structures that are found within the nucleus of animal and plant cells.…
Q: 8. DNA → TAC AGA CGG CAA CTC TGG GTG CTT TGT TCT CTT CTC AGT ATC MRNA → protein >
A: The Central Dogma in molecular biology is one of the most important concepts which throws light on…
Q: 2) Create an mRNA strand based on the given DNA template strand: TACTT CCTATTITCT TGTCA CCGCACT TIT
A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
i just need help in the answers thanks
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 5. Homologous chromosomes move towards opposite poles of a dividing cell during... a. mitosis b. meiosis I c. meiosis II d. fertilization e. binary fission 6. Meiosis II is similar to mitosis in that... a. homologous chromosomes synapse b. DNA replicates before the division c. the daughter cells are diploid d. sister chromatids separate during anaphase e. the chromosome number is reduced 7. Metaphase of meiosis I and meiosis II differ in that... a. chromosomes line up at the equator b. homologues line up in meiosis I and duplicated chromosomes line up in meiosis II c. sister chromatids line up in meiosis I and chromosomes line up in meiosis II d. there are the same number of chromosomes 8. Asexually reproducing organisms produce offspring that are genetically identical to each other and to the parents. What type of cell division are the offspring a product of? a. mitosis b. meiosis c. binary fission d. fertilization 9. At which stage of meiosis do chromatids separate and become…CRITERIA MITOSIS MEIOSIS a. chrosomosomes number of daughter cells b. number of cell divisions c. stages d. Presence of synapses e. presence of crossing over f. cell type that undergoes cell division g. number of daughter cells formed h. DNA content of cells at start of division i. DNA content of daughter cells j. genetic consequences1. Define homologous chromosome. 2. Define sister chromatids. 3. Identify whether each process below occurs during mitosis, meiosis, or both. a. Sister chromatids separate b. Haploid cells are formed c. Cell division occurs once d. Homologous chromosomes pair e. 4 haploid cells are the final result f. Crossing over occurs g. Replicated chromosomes line up in the middle of the cell h. 2 diploid cells are the final result
- 3. Identify the following: a. the sex cell produced by the female b. cell division in which two cells, each with the same number of chromosomes identical to the parent, are produced from one cell c. cell division that results in the formation of four sex cells, each of which has half the number of chromosomes as the parent cell d. a cell part that organizes the web along which chromosomes move during cell reproduction e. a jellylike, living substance inside the cell membrane but outside the nucleus f. the creation of a new organism through the union of an egg and a sperm g. the union of a male sex cell (a sperm) and a female sex cell (an egg) h. the strands of material that determine traits of daughter cells (deoxyribonucleic acid) i. refers to any trait or material that determines characteristics passed on from the parent(s) j. a group of molecules used as both building materials for cell growth and as a control factor for cell behaviorThe haploid gametes of a diploid organism with 2n = 98 chromosomes would contain how many chromosomes? а. 14 b.33 с. 49 d. 98 е. 196 QUESTION 47 2 During the cell cycle, in which sub-phase(s) of interphase does the cell replicate its chromosomes? O a. G1 phase b. S phase c. G2 phase Od. G1 and G2 phases e. G1, S, and G2 phases7. Which of the following statements correctly compares mitosis and meiosis? a. Cells that undergo mitosis divide one time and result in 4 genetically identical daughter cells. Cells that undergo meiosis divide once and result in 2 daughter cells that are not identical b. Cells that undergo mitosis divide one time and result in 2 genetically identical daughter cells. Cells that undergo meiosis divide twice and result in 2 daughter cells that are not identical. c. Cells that undergo mitosis divide one time and result in two genetically identical daughter cells. Cells that undergo meiosis divide twice and result in 4 daughter cells that are not identical. d. Cells that undergo mitosis divide one time and result in 2 cells that are not genetically identical. Cells that undergo meiosis divide twice and result in 4 daughter cells that are genetically identical.
- 1. Which of the following is NOT an importance of mitosis? a.It facilitates growth of single fertilized egg to an individual. b.It heals wounds and replaces damaged or lost organs through regeneration c.It ensures equal distribution of nucleic material down to each daughter cell. d.It produces new chromosome combinations. 2. Why are cell cycle control points are so important? a.They help prevent cells with damaged DNA from dividing b.They determine how quickly a cell’s DNA gets copied c.They ensure that mitosis occurs continuously in all body cells d.They ensure that metaphase always follow anaphase 3. Which component of the plasma membrane allows the immune system to differentiate between body cells and foreign cells or tissues? a.integral proteins b.carbohydrates c.cholesterol d.peripheral proteins e.phospholipids 4. Cyanide is a chemical that affects the function of mitochondria affecting the energy processing of…1. Which of the following is NOT an importance of mitosis? a.It facilitates growth of single fertilized egg to an individual. b.It heals wounds and replaces damaged or lost organs through regeneration c.It ensures equal distribution of nucleic material down to each daughter cell. d.It produces new chromosome combinations. 2. Why are cell cycle control points are so important? a.They help prevent cells with damaged DNA from dividing b.They determine how quickly a cell’s DNA gets copied c.They ensure that mitosis occurs continuously in all body cells d.They ensure that metaphase always follow anaphase14. When the genetic materials are improperly replicated and error cannot be corrected the cell proceeds to: O A. Interkinesis B. Apoptosis C. Prophase I D. Mitotic division O E. Meiotic division 15. The frequency of mitosis would be greater in: O A. All types of cells B. Plant tissue than animal tissue C. Cells at the growing (meristematic) region of a plant than in other somatic (body) cells O D. Sex cells than somatic (body) cells E. Animal tissue than plant tissue O O O OO O OOOO
- 4. Interpret the following images (hint: first describe each as _n=________chromosomes.) A B a. Indicate which diagram shows the following: C one daughter nucleus after telophase of mitosis? one daughter nucleus after telophase of meiosis I? one daughter nucleus after telophase of meiosis II? one nucleus during prophase of mitosis? 88 P b. Which of these diagrams does not fit with the others? D n= n= n= _n= E _1_x Indicate how much DNA is in each compared to its respective gamete which has 1x amount of DNA. In what way is it different? X1. What process enables the body to heal after an injury? a.cell cycle b.mitosis & meiosi c.meiosisd.mitosis e.none of them 2. Checkpoints in the cell cycle control system ___________. a.stop cells from dividing b.regulate the cells by stop and go signals c.signal cells to undergo mitosis d.ensure that a cell keeps dividing 3. Which statement is TRUE about meiosis? * a.It retains the number of chromosome number. b.It reduces the chromosome number by a quarter. c.It doubles the chromosome count in gametes. d.It reduces the chromosome number by half.8. List three ways that mitosis differs from meiosis: a. b. C. 9. Define the following terms: a. Homologous chromosomes: b. Tetrads: c. Haploid: MEIOSIS MITOSIS Laboratory 3 Cell Anatomy and Divisio O bluedoor, LLC