Please Explain 1. You are studying regulation of per1 gene expression in eukaryotic cells, and detectamounts of Per1 mRNA and protein in normal cells and in mutant cells lacking a proteinCLOCK as shown in the figure below.Per1 MRNA expressionPer1 protein expressionNormalCells lackingNormalCells lackingcellsCLOCKcellsCLOCKa. From the graph, describe briefly per1 gene regulation in normal and mutant cells inpresence or absence of the CLOCK protein?b. What type of functional protein do you think CLOCK is?c. Describe two possible biological processes that the normal cell could regulate in orderto increase the amount of Per1 mRNA and protein.

PER1 transcription is regulated by protein interactions with its five E-box and one D-box elements…

Answered: 1. You are stuaying regulation of peri…

1. You are stuaying regulation of peri gene expi amounts of Per1 mRNA and protein in normal cells and in mutant cells lacking a prot CLOCK as shown in the figure below.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter31: Animal Tissues And Organ Systems

Section: Chapter Questions

Problem 1CT: IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may...

See similar textbooks

Similar questions

IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
8. Yeast genes have cis-acting elements upstream oftheir promoters, similar to enhancers, called upstreamactivating sequences or UASs. Several target genes involved in galactose utilization are regulated by onetype of UAS called UASG, which has four bindingsites for an activator called GAL4. Two target genesregulated by UASG are GAL7 and GAL10. The GAL80 protein is an indirect repressor of GAL7 and GAL10transcription: At UASG, GAL80 binds to GAL4 protein and blocks GAL4’s activation domain. In thepresence of galactose, GAL80 no longer binds GAL4.In which gene(s) (GAL4 and/or GAL80) shouldyou be able to isolate mutations that allow the constitutive expression of the target genes GAL7 andGAL10 in the absence of galactose? In each case,what characteristics of the protein would the mutationdisrupt?
. An interesting mutation in lacI results in repressorswith 110-fold increased binding to both operator andnonoperator DNA. These repressors display a “reverse”induction curve, allowing β-galactosidase synthesis inthe absence of an inducer (IPTG) but partly repressingβ-galactosidase expression in the presence of IPTG. Howcan you explain this? (Note that, when IPTG binds a repressor, it does not completely destroy operator affinity,but rather it reduces affinity 110-fold. Additionally, ascells divide and new operators are generated by thesynthesis of daughter strands, the repressor must findthe new operators by searching along the DNA, rapidlybinding to nonoperator sequences and dissociating fromthem.)
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
1. The following image shows a mechanism in which gene expression activity is regulated by ligand. Arg RS-2 Teu Met RBS Ligand RBS hidden a. What is this kind of regulatory machnism called? b. Does it involve transcription or translation? c. What happens in the presence of the ligand? d. What happens in the absence of theligand? e. What do you think the genes that are regulated here - metabolic (breakdown) or anabolic (buildup) for the ligand? Explain
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…
a. Would you expect a cell to continue or to stopdividing at a nonpermissive high temperature if itis a temperature-sensitive Ras mutant whose protein product is fixed in the GTP-bound form atnonpermissive temperature?b. What would you expect if you had a temperaturesensitive mutant in which the Ras protein staysin the GDP-bound form at high temperature?
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…