Answered: 1) Transcription and translation both…

1) Transcription and translation both involve an initiation, elongation, and termination phase. Describe how each of these phases occurs for both transcription and translation.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Related questions

Q: If someone vapes constantly and is absorbing many toxins in the process which are screened via the…

Q: What can you conclude from the karyotype shown below? 2 3 7 8 10 12 13 O a) This individual has a…

A: Karyotype : The number , sizes and the shapes of the metaphase chromosomes constitute the karyotype…

Q: Exchange of genetic information between two non-homologous chromosomes is called? Inversion…

A: Introduction Chromosome:- A structure found inside the nucleus of a cell, It is an organized package…

Q: Which of the following human ligament is called y shaped ligament of Bigelow? a) The glenoidal…

A: Introduction - Ligaments are tissue bands that help link and hold bones, joints, and organs in…

Q: Ana was tasked to measure the actual magnification of her specimen mounted on a slide without…

A: A light microscope or optical microscope is used to study a thin section of a rock. The section is…

Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…

Q: Which of the following part of human skeleton forms the helmet for the protection of human brain? a)…

A: Brain Brain is the complex organ of an organism which controls all other part of the that organism.

Q: What is extracellular digestion?

A: The question is related to digestive system. It is asking about extracellular digestion.

Q: heartbeat using all relevant structures, especially SA and AV nodes and Purkinje fibers.

Q: Describe the arrangement of floral members in relation to their insertion on thalamus?

A: Flower is the reproductive part of the plant. It produce seeds through reproduction. Once the…

Q: form a strong inner lining of the nuclear envelope and provide anchoring sites for interphase…

A: The nuclear membrane is comprised of two phospholipid bilayers. The membrane facing the cytoplasm or…

Q: What are the complications of the disease if the patient is not treated?

A: Schistosomiasis is a parasitic infection that is caused by parasites of the genus Schistosoma. These…

Q: Shown below is a very short gene of an unknown bacteria genome (Figure 2). Transcription starts at…

A: Transcription proceeds until the main enzyme RNA polymerase encounters a termination sequence that…

Q: Please help me identify which of the following apply to the specimin I have attached in the images.…

A: The human skeleton has 206 bones, omitting teeth and sesamoid bones. There are 126 appendicular…

Q: Somatic stem cells are best described as ...

A: Since the cells are somatic they would not divide through out life. They are not at dysregulated.…

Q: What are cells with a delimited nucleus called ? What are the main elements of the nucleus?

A: Introduction - The nucleus is located in the centre of the cell and houses DNA organised into…

Q: What slide preparation technique should you use for the following goals?

A: Slide preparation begins with the fixation of your tissue specimen.

Q: Discuss how classification systems have undergone several changes over a period of time?

A: With the passage of time, the classification systems have undergone numerous modifications.…

Q: Choose insect order(s) that belong to Paleoptera. O Coleoptera |Ephemeroptera O Hemiptera Odonata

A: Insects can be referred to as the members of the phylum Arthropoda's biggest class. Insects possess…

Q: Describe the process of urine formation in the kidney using all relevant structures of a nephron.…

A: The process of urine formation can be explained in three steps. These three steps are, i)…

Q: Measurements taken at a lake in Kenya have a pH level of 10.5, temperature of 305 K and salinity of…

A: Extremophiles are organisms that are able to grow in extremely harsh environments such as high salt…

Q: What is the sequence of GC-rich box in 3' to 5' direction? GCGCGC GGGCGG CCGCCC GGCGGC

A: Introduction GC box increases the amount of transcription for that gene when present in a…

Q: 1. In humans, widow’s peak (W) is dominant over having a straight hairline (w). If a homozygous man…

A: Since you have posted multiple parts, we will solve the first question for you. To get the remaining…

Q: What are the external parts and function of shark? 2. What are the external parts and function of…

A: Animal anatomy deals with the structural relationships and physical characteristics that represent…

Q: Which of the following part of the human brain has a center for controlling breathing? a) Medulla…

A: Introduction - The brain is a complicated organ that regulates our body's thought, memory, emotion,…

Q: Which of the mechanisms efficiently and effectively organize the DNA into a usable form?…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: Osteocytes are bone cells. Collagen fibers and calcium salts are found in abundance between and…

A: Earlier osteoblasts that have become entrenched in the bone are known as osteocytes. Osteocytes are…

Q: What are the reasons for the unprecedented increase in life expectancy that occurred in the 20th…

A: Life Expectancy is defined as the average number of years humans can survive. Currently, life…

Q: true/false 1. Spruce budworms do not feed on cones, and they exclusively feed on needles. 2. Many…

A: The insects or Insecta are the largest groups in phylum Arthropoda with the most diversity of…

Q: what is the present microorganisms in soft swell spoilage?

A: Canning is a type of food preservation method, which includes the preservation of food in air tight…

Q: 2. Most tumors that originate in the brain are not cancer, but growth of any tumor within the…

A: Tumor cells have the capability of uncontrolled cell division. The cells divides and produce a…

Q: What is the difference between the conservative and semiconservative replication?

A: DNA stands for deoxyribonucleic acid. DNA replication is the process in which the exact copy of DNA…

Q: What is the order of the taxon from LARGEST to SMALLEST? * Choose one: a. Domain, Kingdom, Phylum,…

A: The scientific study of naming, defining, and classifying groups of biological organisms based on…

Q: Why do glucagon and epinephrine have the same effect on glycogen metabolism and not in glycolysis?

A: Glucogon is the hormone secreted from alpha cells of islets of Langerhans in pancreas. Epinephrine…

Q: A continuously growing population of bears has a population size of 500 and its intrinsic rate of…

A: Let us look at the given data - Initial Population size (N0) = 500 Intrinsic rate of increase (r) =…

Q: 3. We have leamed a bit about the ATP/ADP+P cycle and substrate-level phosphorylation thus far.…

A: ATP (Adenosine triphosphate) is the energy source of living organism. When it break, it convert from…

Q: What does corpus callosum connects in human brain? a) Two optic lobes b) Bone and muscle c) Two…

A: Introduction - The brain is the central organ of the human nervous system, which is made up of the…

Q: Create an Schematic representation of protein digestion, absorption and nitrogen secreation

A: Digestion of protein is a process in there, protein is break down in to amino acid. The digestion of…

Q: Discuss three ways by which the human body is capable of utilising one single ligand in several ways…

A: A ligand is an ion or molecule that forms a coordination complex by donating two electrons to the…

Q: What happens to individuals with defects in regulatory T cells (Treg)?

A: TReg or regulatory T cells are necessary for regulating peripheral tolerance as well as avoiding…

Q: what is diabets and how can affect urine composition

A: Types of diabetes Type 1 diabetes ( insulin dependence) Type 2 diabetes ( insulin resistance) Type 3…

Q: true/false 1. Proboscis of butterflies is a modified organ of labial palpi. 2. Diptera has one…

A: The insect belongs to the class Insecta or Hexapoda, any member of the largest class of the phylum…

Q: what is the present microorganism in soft swell spoilage?

A: Food spoilage refers to food that has been damaged orinjured that makes it undesirable for human…

Q: How can you tell a male pig from a female pig externally? Oral Cavity 3. What do the hard and soft…

A: Answer 1 :- Male and female pig can be differentiated based on the opening of the urogenital sinus.…

Q: Choose the statement that best describes the difference between mitosis and meiosis Mitosis is…

A: option C - Mitosis is equal division without genetic variation ; Meiosis is reduction division with…

Q: During which phase, chromosomes condense as part of the cell cycle? Metaphase Prometaphase O…

A: Cell cycle includes the series of events that produces daughter cells from parent cell.

Q: Do we have any moral obligations toward any animals? What is the extent of these obligations? Why do…

A: Animals are the multicellular, eukaryotic organisms belonging to the biological kingdom, Animalia.

Q: One hundred rabbits are introduced to a new environment. Fifty rabbits are brown and 50 are white.…

A: * Genetic drift refers to random fluctuations in frequencies of alleles from generation to…

Q: Question 3 List three species of bacteria (using complete genus and species names, correct binomial…

A: Bacteria are small unicellular creatures that lack a well-defined nucleus, have circular chromosomes…

Q: Biologists classify both ribosomes and spliceosomes as "ribozymes" because ... they both contain…

A: Please follow step 2 for a detailed explanation.

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

Chapter 7 - Transcription and
Translation
Pick either one of the following to answer:
1) Transcription and translation both involve an initiation, elongation, and
termination phase. Describe how each of these phases occurs for both
transcription and translation.
OR
2) Both transcription and translation involve modifications following the
termination step. Describe these modifications and the importance of
each modification to complete the final product.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.
BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Contrast transcription and translation. Name at least three differences between the two processes.
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
a. Use the genetic code provided in class to predict the sequence of protein formed from the following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? CGCUCCAUCUUU d. Which mutation is more likely to result in a slightly altered, but still functional, protein, the frame shift mutation or the point mutation? Briefly explain your answer.
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third base
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an