The derivation of protein secretion system from a DNA (deoxyribonucleic acid)-pumping system. Introduction: Bacterial secretion system refers to the secretion system of bacteria that gives the pathogenic bacteria a peculiar mechanism of virulence. It helps them to bypass the external cellular environment and inject their bacterial effector proteins directly into the host cell. The secretory systems are categorized on the basis of specific structure, activity, and composition.

Question

Want to see the full answer?

Answer 1

Question

Chapter 25.5, Problem 1TQ

Summary Introduction

To review :

The derivation of protein secretion system from a DNA (deoxyribonucleic acid)-pumping system.

Introduction:

Bacterial secretion system refers to the secretion system of bacteria that gives the pathogenic bacteria a peculiar mechanism of virulence. It helps them to bypass the external cellular environment and inject their bacterial effector proteins directly into the host cell. The secretory systems are categorized on the basis of specific structure, activity, and composition.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The role of GTP hydrolysis in actin polymerization is similar to the role of ATP hydrolysis in tubulin polymerization: both serve to weaken the bonds in the polymer and thereby promote depolymerization. Is that true or false? why?

Protein 2: DNA AGAGTTCTGCCCTGTCGATTT MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?

Please help me with this question. More than one answer may be correct. The + side of a microtubule _____. Options: A) will be attached to the cell membrane B) will have a β subunit C) will have a high rate of polymerization than the - end D) will have an α subunit E) will have a lower rate of polymerization than the - end