The genetic code is Random in that the codons for the same amino acid are structurally unrelated Read by pairing codons in TRNAS with anticodons in mRNAs Read by pairing anticodons in tRNAS with codons in MRNAS Redundant in that each codon can code for multiple amino acids

The genetic code is Random in that the codons for the same amino acid are structurally unrelated Read by pairing codons in TRNAS with anticodons in mRNAs Read by pairing anticodons in tRNAS with codons in MRNAS Redundant in that each codon can code for multiple amino acids

Name: The genetic code isRandom in that the codons for the same amino acid
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The genetic code isRandom in that the codons for the same amino acid are structurally unrelatedRead by pairing codons in TRNAS with anticodons in mRNAsRead by pairing anticodons in TRNAS with codons in MRNASRedundant in that each codon can code for

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.
In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a codon if only the first two nucleotides of the codon are known?
For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGA
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table, translate this sequence, assuming the first three nucleotides are a codon.
The relaxation of base-paring rules between the TRNA and MRNA is termed as Answer:
Translate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code Second letter of codon UAU UUU Phenylalanine UCU UUC Phe) Tytosine (Tyr) UGU Cysteine (Cys) UGC UCC Serine (Ser) UCA UCG CCU UAC UA Stop codon UXG Stop codon 1oG Stop codon UGS Tryptophan (Trp) CGU CC UUA Leucine (Leu) UUG CAU Histidine (His) CAC CUC Leucine (Leu) CUA Proline (Pro) CA Arginine (Arg) CAR Glutamine (Gin) CGA CUG AUU AUC AUA CAG AAU AAC ACU Isoleucine (le) Asparagine (Asn) AGU Serine (Ser) ACC Threonine (Thr) ALA ARC GAU GAC ACA ACC GCO Methicnine: Lysine (Lys) AGA Arginine (Arg) AGS start codon GUU Aspartic acid (Asp)GGU GUC Valine (Val) GUA GCC Alanine (Ala) GO Glycine (Gly GCA GCG GAA Glutamic acid (Glu) GGA GUG GAG GGG methionine-isoleucine-proline. AUG AUU CCU UAC UAA GGA tyrosine-leucine-glycine First letter of codon Third letter of codon
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…
Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon