Problem 3: Nitrous acid causes all possible transition mutations, CT and G A. If the normal sequence of a protein contains a valine residue (val) at a particular place, what new amino acid(s) would most often appear in place of the valine residue as a result of nitrous acid mutagenesis? Use a codon chart.
Q: Challenge #2: When you are given the amino acid, there are MULTIPLE possible MRNA and DNA codons,…
A: The DNA is transcribed into RNA by the process of transcription and then the RNA is translated into…
Q: You discovered a halophilic bacterium and want to characterize the mechanism involved in producing…
A: The tRNA (transfer RNA) takes part in polypeptide synthesis by bringing in the amino acid to the…
Q: 24. TRUE or FALSE: A microRNA (in red) binds to its mRNA target (black) as shown below:…
A: False The target will be cleaved.
Q: Q-2: (a): The diagram below symbolizes different regions along a gene encoding a mRNA. Translation…
A: AUG is the sequence of the start codon. An mRNA will have the sequence AUG in many places, but only…
Q: Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on…
A: Mutations are changes that occur in the genetic sequence of an organism. These changes alter the…
Q: What is the role of tRNA? To replace T with U when transcribing mRNA. To bind the ribosome and the…
A: According to the question, we have to mention the role of tRNA among the given options. So, let us…
Q: Complete the following problems. 1. Draw a molecule of phosphatidyl serine using palmitic acid and…
A: Phosphatidylserine is a phospholipid which consists of two fatty acids attached in ester linkage to…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: Task 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…
A: BASIC INFORMATION PCR It is time for polymerase chain reaction. It is a method to amplify small…
Q: Question: Genetically modified animal that might be approved for human consumption is a super…
A: Introduction CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats. This is…
Q: Question 7 Review noncoding DNA. Match the description. In primates, a large portion of transposable…
A: In primate a large portion of transposoble element related dna usually about 300 nulceotide long…
Q: Practice 26: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino…
A: Transcription is the process of synthesis of mRNA from DNA. During the translation process, the mRNA…
Q: Instructions Your task in this section is to build a bacterial replisome at the replication fork.…
A: DNA replication is the process, where DNA is replicated using its own machinery. DNA replication is…
Q: Question:- Is DNA sequencing a in vivo, in vitro and/or in silico? What product(s) is/are formed…
A: In vivo processes are processes done within the cell.In vitro processes are processes done in an…
Q: Question Image hown t nallest Q. A gel from gel electrophoresis is shown below. Which DNA fragment…
A: A technique that is used for the separation of fragments of DNA on the basis of charge and size is…
Q: Problem B. DNA: Codon Segmenting The way that DNA is often interpreted as genes is in groups of…
A: An open reading frame (ORF) is the segment of DNA (deoxyribonucleic acid) sequence that can be…
Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…
A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…
Q: What biological rationale can explain why there are so few variants observed at position 65 of the…
A: The iron atom in the heme group can form a total of 6 coordinate bonds . 4 of these are formed with…
Q: Question Genes can be transcribed into mRNA, in the case of protein-coding genes, or into RNA, in…
A: Gene is a nucleotide DNA sequence which forms the basic physical and functional unit of heredity.…
Q: Question Completion Status: A 2.0kb bacterial plasmid 'BS1030' is digested with the restriction…
A: Restriction enzymes cleave the DNA at palindromic sequences. Plasmids are circular DNA molecules.…
Q: Practice question #1 (Fill in parts A, B, and C) 1. Within the cytoplasm or ER, are synthesized by…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…
A: Q1. STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2:…
Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…
A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…
Q: Questions and situational problems I. A particular gene codes for a mature mRNA containing 900…
A: Mutations are the changes in the DNA sequence of an organism.
Q: Practice question: Page 112 Ex: 2 True of False Each answer must be justified with a short…
A: Explanation to D: - A sigma factor or also known as Specificity Factor is a protein needed for…
Q: Question Completion Status: You are studying a group of individuals with X-ray vision and perform…
A: Colonies having X ray genes :-
Q: Practice Question 2 The beginning of the hexose kinase gene's sequence can be found below, the +1…
A: DNA replication in is semiconservative, semi-continuous, and bidirectional. It occurs in the S phase…
Q: Question 5. Read mapping is typically the most computationally-intensive step in RNA-seq data…
A: Mapping the reads of an experiment to a reference genome is a key step in modern genomic data…
Q: Question- There are 2x10-3 mutations in every replication of a given strain of bacteria, and this…
A: Given information Number of mutations in one replication - 2x10-3 Time for one replication is = 30…
Q: Association for the Advancement of Science. Reprinted with permission from AAAS. FIGURE 6.13 16- 16…
A: RNA Folding and Unfolding: It's the process of a linear ribonucleic acid molecule acquiring…
Q: Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU…
A: Translation is the process where protein (amino acids) is synthesized from mRNA molecule that is…
Q: Problem 10. When does DNA replication take place? during the S phase of the cell cycle…
A: DNA replication is a complex process that involves various enzymes and stages that are relatively…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: Which of the following statements is FALSE? Select one: a. G-C bonds are much more resistant to…
A: DNA and RNA show our genetic constitution.
Q: inans 5' 3' MRNA For our Unit 12 discussion on gene expression, please answer the following: 1.…
A: The genetic material in the cell contains various genes that codes for mRNA ( messenger RNA) by…
Q: STAMENT 1: Transfer RNA is the RNA that contains anticodon STAMENT 2: The tail added to an mRNA to…
A: Hello dear student you have asked more than one different questions in a single slot, we could only…
Q: what are the differences between mitochondrial RNA polymerase and RNA polymerase ? and why does…
A: *The mitochondrial transcription is a multi-component system consisting of, at minimum, the…
Q: 20-22. TBX5 is a gene found in vertebrates which is expressed in the heart and forelimbs during…
A: Transcription is a process in which the double-stranded DNA template strand is transcribed into a…
Q: Updates Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal…
A: Sickle cell anaemia is a genetic disease caused by an abnormal haemoglobin. The resulting change in…
Q: PROBLEM 21 Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in…
A: At the time of transcription;only one strand of DNA is transcribed.This strand is known as template…
Q: What is mutation? Distinguish between a gene mutation and a chromosomal mutation?
A: The genome is made up of one to several long DNA molecules, and mutations on these molecules can…
Q: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: 2.7 Problem in the Determination of Molecular Welght by Gel Electrophoresis A puri- fied recombinant…
A: SDS PAGE, abbreviation of Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis is a laboratory…
Q: Reset Help defined as changes in the sequence of Mutations DNA frameshift mutations caused by…
A: a- mutagens (mutations caused by environmental factors) d- carcinogens (mutagens include cancer…
Q: Draw and Label what is happening in this scenario: The antibiotic erythromycin disrupts protein…
A: Erythromycin disrupts protein synthesis by binding to the 50S subunit of ribosome. It prevents…
Q: Exercise 15. What is the resulting amino acid sequence from the parent DNA double helix as follows?…
A: The first step in decoding genetic messages is transcription, during which a nucleotide sequence is…
Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…
A: RNA is called ribonucleic acid. RNA has several different forms based on their function and these…
Q: What is Cot analysis? Do the Cot renaturation curves for a virus, bacterium, and yeast all roughly…
A: C0t analysis, which is based on the principles of DNA reassociation kinetics, is a biochemical…
Q: 20-22. TBX5 is a gene found in vertebrates which is expressed in the heart and forelimbs during…
A: Two primers are used in PCR reaction a forward primer and a reverse primer. They are designed in the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutationGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
- 2. The following polynucleotide was synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. -· AUAUAUAUAUAUAU- .. What polypeptide would you expect to be produced? What information would this give you about the code? 3. If the same polynudeotide described in Problem 2 is used with a mitochondria-derived cell-free protein-synthesizing system, the product is ... Met-Tyr-Met-Tyr-Met-Tyr- .. What does this say about differences between the mitochondrial and bacte- rial codes?48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter. A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′ ACGATGGAA 5′CodonIf mismatch repair occurs in either direction, whichamino acids could be found at this site?
- Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and want to determine the genetic code of its mitochondria. Here are the amino acids encoded after translation of two synthetic mRNAs using mitochondrial extracts from your eukaryote- in this experiment translation can start at any sequence position: RNA: Protein: Tyr-Met-Tyr-Met-Tyr-Met---- UAUAUAUAUAUAUAU--- UAAUAAUAAUAAUAA--- Asn-Asn-Asn-Asn-Asn---- Met-Met-Met-Met-Met---- Based on the results shown here, what can you conclude about the codons in this eukaryote? A. B. C. D. O A O C OD OB AUA Tyr Met Tyr Met UAU Met Tyr Met Tyr AAU Met Trp Asn UAA Asn Asn Asn Asn, STOP or Met Asn, STOP or MetPlease do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases. a. Class I synthetases acylate the terminal 2’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 3’ hydroxyl group of tRNAs. b. Class I synthetases acylate the terminal 3’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 2’ hydroxyl group of tRNAs. c. Class I synthetases acylate tRNAs with hydrophobic amino acids; Class II synthetases acylate tRNAs with polar amino acids. d. Class I synthetases acylate tRNAs with polar amino acids; Class II synthetases acylate tRNAs with hydrophobic amino acids.
- SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/ACorrect! The Leu codon is changed to a nonsense codon by a single-base substitution How many different ways can the LEU codon be changed into the nonsense mutation? 3621101. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. ..AUAUAUAUAUAUAU-… What polypeptide would you expect to be produced? Precisely what information would this give you about the code? 2. If the same polynucleotide described in Problem 1 is used with a mitochondria-derived cell-free protein-synthesizing system, the product is .Met-Tyr-Met-Tyr-Met-Tyr-.. What does this say about differences between the mitochondrial and bacterial codes?