Q: 1. Types of transport of substances through the membrane: passive transport (facilitated diffusion…
A: Introduction Transportation across the cell membrane can occur via active or passive transport. The…
Q: What advantages are there to using plant associated microorganisms rather than animal associated…
A: Xanthan gum is a polysaccharide food ingredient derived from the bacterium Xanthomonas campestris…
Q: State whether TRUE or FALSE. Explain your answer Reverse transcription occurs naturally in the…
A: Reverse transcription is mainly an event in which RNA is converted into c-DNA.This is mainly done by…
Q: Describe post-translational modifications and protein-protein interactions that occur and play role…
A: The IgG1 subclass, which is the most prevalent in human serum, is crucial for triggering immune…
Q: T = Tall t = short pollen from a tall pea plant T T eggs from a tall pea plant T TT TT t Tt Tt In…
A: ANSWER) In the given cross the Tall plant with genotype TT is crossed with the short plant of…
Q: Problem #3 Hemophilia is a recessive trait carried on the X chromosome. What are the genotype and…
A: Hemophilia is a recessive disease meaning that when both the X chromosomes in females are affected…
Q: Outgroup Cow Deer Hippo Pig Peccary Camel Whale (b) Outgroup Cow Deer Whale Hippo Pig Peccary Camel…
A: From the given picture of phylogenetic tree, it is clear that pigs, deer, cattle and camels gained…
Q: 2. Complete the following chart. Carbohydrates Function Monomer Bond Example (in the human body)…
A: 2) Carbohydrates, proteins, lipids, & nucleic acids are the 4 main types of biomolecules found…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: Direction: Read and analyze the following laboratory experiment and answer the following question.…
A: Indipendent variable :- It is the cause, we study and the value of independent variable is…
Q: Without oxygen, life cannot exist. Select one: True False
A: Introduction : Respiration is the process through which the nutrients we eat are converted into…
Q: 13 Write the complementary sequence to following DNA strand: AATTCGCCGGTATTA (1 Point) * Enter your…
A: DNA has two strands. Every DNA sequence has a complementary sequence.
Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…
A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…
Q: RAE1 molecules are expressed by stressed cells, including some tumor cells. What would be the…
A: RAE1 (Retinoic acid early inducible 1) is a protein that is expressed by stressed cells, including…
Q: Compare physical and chemical control of microbes and give an example of each.
A: Microorganisms are referred to as that organism that is single-celled and can only be visualized…
Q: Describe post-translational modifications and protein-protein interactions that occur and play role…
A: The IgG1 subclass, which is the most prevalent in human serum, is crucial for triggering immune…
Q: What indicator of plankton is alloxantin?
A: Plankton These are the organisms located in water that are unable to propel themselves against a…
Q: Read the Guilty dentist information. Then use your understanding to answer the following question:…
A: A diagrammatic representation of biological entities related via common descent, like species or…
Q: During the light dependent reactions of photosynthesis, the solar energy absorbed by the chlorophyll…
A: ANSWER : 3) energise ATP synthase to make ATP for the Calvin-Benson cycle. 4) move electrons down…
Q: If there are 24 chromosomes in a somatic cell in the Gap 1 of the cell cycle, what is the diploid…
A: Somatic cells are haploid.somatic cells compose the body of the organism and undergoes the process…
Q: for evolutionary biologist Do you think the content for eveolutionary biology is valid, credible,…
A: Evolution is a process which explain the present diversity of life on earth. It explains how life…
Q: Given the shedding rate of skin flakes for the average person,
A: The overall efficiency of the garment is calculated as the ratio of the shedding rate of particles…
Q: Study the table and graphs below. Record what you observe in the table or graph in the “What I See”…
A: Carbon dioxide is released by cellular respiration by living organisms. It is produced by the…
Q: What conclusions can be drawn from the table ?
A: Introduction- The Cardiac CycleRefers to the events of 1 complete heart beat- Both atria &…
Q: Determine the patterns of inheritance of the following X-linked dominant cases by giving the results…
A: X Linked dominant inheritance means the genes present in X chromosomes, if the gene has dominant…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Which of the following statements is TRUE about NK cells? Select an answer and submit. For keyboard…
A: Natural Killer (NK) cells are a type of cytotoxic immune cell that play a role in the rejection of…
Q: Blood volume in an organism, structure of blood, hematocrit
A: Introduction: Blood: liquid that moves carbon dioxide and other waste items away from the body and…
Q: Where does absorption of nutrients happen in the vertebrate digestive system?
A: Digestion is a process in which the conversion of complex food substances into simpler absorbable…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…
A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…
Q: Some species undergo polyploidy, which is a multiplication of their chromosomes. That is, they…
A: Polyploidy is the condition of possessing more than two genomes. The diploid cell acquires…
Q: 1. Which of the following pairs is mismatched? None of the pairs are mismatched Joseph Lister -…
A: Introduction:- Antibiotics are the drugs or medicines which are used to treat the bacterial…
Q: Parameters Promoters Initiation Elongation Termination Differences in Transcription Process…
A: Transcription is the process in which the nucleotide sequences of a gene are transcribed into mRNA…
Q: define biomonitoring.
A: Biomonitoring is a process of monitoring the health and/or environmental quality of an environment…
Q: Which of these is not a component of plant ecology? The classification of new species Interactions…
A: Plants also play a critical role in human well-being. Plant ecology is important because plants play…
Q: Name the 7 structures of the conductive zone. What is their role?
A: The ear is a complex organ that is responsible for converting sound waves into electrical signals…
Q: explain what a bootstrap value is and why the information it provides is useful.
A: bootstrap value is the proportion of replicate phylogenies that recovered a particular clade from…
Q: which of these is a/arepossible treatment option(s) for the disease(s) caused by mutations within…
A: A. Surgery - Surgery is a procedure that involves cutting of a patient's tissues or closure of a…
Q: ations by assigning the prop
A: Histidine is a major amino acid that plays a crucial role in protein biosynthesis. Histidine amino…
Q: You observe a cell through a microscope and see that it has mitochondria. To which Domain of…
A: Living organisms have been classified in many ways, grouping the similar organisms together based on…
Q: Identify the glands of the endocrine system. Choose your answer from the box below.
A: Hormones are the chemical messengers of the body that travel through the bloodstream and help to…
Q: Discuss the effects of a named toxin on the human body. Please include details of the mechanism of…
A: Animals and plants can produce compounds called toxins that are dangerous (toxic) to humans. Some…
Q: describe the structure and function of spinal cord as part of central nervous system .
A: The central nervous system is made up of the brain and spinal cord (CNS). In humans, the spinal…
Q: p codon between gal and insulin parts? How do you separate the gal part from insulin insulin part B?…
A: Insulin biochemically, is a hormone and structurally it is composed of two chains that are cross…
Q: The results of this study provided opportunities for further research. What may be a hypothesis…
A: Insect migration success is dependent on temperature Insect population numbers are affected by land…
Q: Explain how effector cells, antibodies and other effector molecules can cause immune-mediated…
A: The immune system of our body responds to external agents (allergens) to protect itself. But…
Q: MODEL 1: 1. His 119 6. His 119 CH O-P-O- 01 HCHO HCH Substrate O-P-O OH +H₂N OOH CH H₂N. His 12 $…
A: Enzymes are the proteins synthesized in the cell by the process of translation from mRNA. The…
Q: There are two main forms of secondary active transport (cotransport), referred to as antiport and…
A: There are a few important points : Active transport occurs against the concentration gradient and is…
Q: 1. What attributes would a microbe need (physical or biochemical) to be able to: a. Travel from…
A: Microbes are small, unicellular, and microscopic organisms. They can be bacteria, viruses, or fungi.…
Step by step
Solved in 4 steps
- The refractory period goes from "absolute" to "relative" when: The inactivation gate of Na+ channels opens up. The inactivation gate of Na+ channels closes. K+ channels begin to open. K+ channels begin to close.Absolute refractory periods in axons: Result from conformational changes in voltage gated K channels after opening O Result from Cl channel induced hyperpolarization O Result from Ca dependent phosphorylation of K channels Result from conformation changes in voltage gated Na channels after opening O Result from Ca dependent phosphorylation of Na channelsIn the dark, bipolar cells are O inactive due to open Cl- channels active due to open Na+ channels inactive due to closed Ca++ channels active due to open Ca++ channels
- Epilepsy is a condition which results in seizures stemming from excessive or abnormal activity of neurons. This can occur either from hyperexcitability of excitatory neurons, or impairment of inhibitory neurons. That is to say, either the excitatory pathways become overactive, or the inhibitory pathways, designed to temper the excitatory pathways, are not active enough. Much of the research done on epilepsy focuses on voltage-gated sodium channels, and to date over 700 different mutations to the channel have been identified as playing a role in epilepsy. The means by which these mutations contribute to epilepsy is quite complex, but for the sake of this CAL, let's simplify and apply what we have learned so far to identify potential mechanisms for this condition. In what way could voltage-gated sodium channels be affected in excitatory neurons which would increase the likelihood of the neuron firing an action potential? (one correct answer) The inactivation gate is slower to close. The…Why do voltage-gated sodium channels have three states (open, closed, refractory/open-block)? Select all that apply. Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ a b с Multiple answers: Multiple answers are accepted for this question d To keep action potentials from going backwards To speed up the refractory period To prevent the channels from opening during repolarization To allow hyperpolarization to occur Answered ResubmitSome have compared the "all or none" action potential to flushing a toilet. The absolute refractory period (when no amount of pressing the lever will produce another flush) is set by: the inactivation of voltage gated potassium channels the inactivation of voltage gated sodium channels the opening of voltage gated sodium channels the inactivation of voltage gated chloride channels
- Action potentials propagate in one direction because of: O K+ Voltage-gated Channels become inactive for a while O Nat Voltage-gated Channels become inactive for a while O K+ nongated Channels become inactive for a while O Nat nongated Channels become inactive for a whilePlace the following events in chronological order from 1-8: Nat enters the cell, and depolarization occurs to approximately +30 mV. The voltage across the cell membrane is -70 mV, the resting membrane potential. Upon reaching the peak of the action potential, the VG Nat channels are inactivated by the closing of their inactivation gate and the activation gate of each VG K channel opens. VG K channels close by the closing of their activation gate, and the resting membrane potential is gradually restored. An excitatory post-synaptic potential depolarizes the membrane to threshold and the activation gate of VG Nat channels open. Upon returning to the resting membrane potential, VG Na channels are reset by opening of the inactivation gate and the closing of the activation gate. VG K+ channels are slow to close, resulting in an excess of K* efflux and hyperpolarization. Depolarization occurs as K+ flows out of the cell.apucreceptors ava ble at the synapse are reflected in this number. Question 2: In this chapter, we discussed a GABA-gated ion channel that is permeable to Cl. GABA also activates a G-protein-coupled receptor called the GABA receptor, which causes potassium-selective B channels to open. What effect would GABAB receptor activation have on the membrane potential? GABAB receptor activation causes potassium-selective channels to open. As a result this bringhs the
- During the relative refractory period, a larger than normal stimulus is required to generate an action potential. Which of the following statement/s explains this situation? O the inside of the cell is hyperpolarized and farther away from threshold O potassium voltage gated channels closed too soon and prevented potassium ions entering the cell potassium voltage gated channels did not all close at the same time and more than the required number of potassium ions exited the cell a and c « Previous NextSome have compared the "all or none" action potential to flushing a toilet. The relative refractory period (when the water level in the tank is below what it is at rest ) is set by: the opening of the voltage gated sodium channels O the inactivation of voltage gated potassium channels the opening of voltage gated potassium channels the inactivation of voltage gated sodium channelsChannel labels Voltage-gated K* channels Voltage-gated Na+ channels Ligand-gated Na+ channels Voltage-gated K* channels lon movement labels K+ exits cell Na+ enters cell K+ exits cell Na+ enters cell Graded potential Depolarization (EPSP) +30 mV -70 Time (msec) +30 mV -70 Depolarization Action potential Time (msec) +30 mV -70 Repolarization Time (msec) +30 mV Hyperpolarization Overshoot -70 Time (msec)