Calculate the number of bacteria (CFU/ml) in each serum and saline sample. What was the purpose of the saline? Which bacteria produced more CFU/ml in serum? Why? Provide a possible explanation for the ability of Pseudomonas to colonize mucous membranes. Reference(s): Include at least 1 valid reference for your research in correct format (either APA or MLA) (2pts)
Q: NO3 reduction: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain…
A: 1. The conditions of incubation Goal: By simulating the natural environment, the incubation…
Q: Match the following labelled frog organs, where the specimen is viewed ventrally and the organs are…
A: Frog: Frog is a tailless, small bodied carnivorous creature. It belongs to the kingdom 'Animalia'…
Q: Using the Pythagorean theorem, either with or without the formula proposed by Archimedes (or by…
A: The objective of the question is to calculate the area of a scalene triangle using the Pythagorean…
Q: Answer the following questions about CRISPR below: A.What is a PAM sequence? B.How does the…
A: A. PAM Sequence:A PAM sequence, or Protospacer Adjacent Motif, is a specific DNA sequence that is…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…
Q: Can you give me the examples of the therapies and drugs?
A: Although there aren't any widely-used treatments or medications that specifically target…
Q: Anaerobic respiration requires great stores of glycogen requires extensive capillaries for oxygen…
A: The question is asking about the requirements and role of anaerobic respiration in human energy…
Q: The pointed structure will differentiate into a. Corona Radiata b. Plasma Membrane c. Granulosa…
A: a. Corona RadiataExplanation: Detailed explanation: a. Corona Radiata:The corona radiata is a…
Q: In Aristotle’s scala naturae, the entoma (insects, chelicerates, and other non-crustacean…
A: The objective of the question is to understand the classification of 'souls' that Aristotle assigned…
Q: What topics about opioids would you try to change to address thenegative impacts of the opioid…
A: Prescribing Practices: This point highlights the need to educate healthcare professionals about…
Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.
A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…
Q: What thoughts do you have on stigma & bias related to opioids, history of opioids, cause of…
A: The opioid crisis is a significant public health issue in the United States, with overdose deaths…
Q: Papua New Guinea is known for its rich biodiversity and unique ecosystem. Write an eassy exploring…
A: The objective of this question is to explore the environmental issues and conservation efforts in…
Q: 1- Compared to the above urine test, if a blood test for glucose correctly identifies 95% of…
A: Sensitivity:• Definition: The ability of a test to correctly identify those with the disease (high…
Q: According to Aristotle’s density equation, if 4.686 grams of the sugar glucose (C6H12O6) occupies a…
A: 4. 1.562 grams/cm3Explanation:
Q: St. Aurelius Augustine, in his theodicy attempting to reconcile freedom and determinism, recognized…
A: The question is asking about the theological implications of St. Aurelius Augustine's theodicy,…
Q: STEM WOrkplace Practices Q5
A: The question is asking about the term used to describe the large particles that are unable to pass…
Q: BF, a 37-year-old male, is scheduled for a same-day surgical procedure for hernia repair. He has no…
A: The objective of the question is to determine the ABO blood type of the individual named BF based on…
Q: Aristotle classified all large, mobile, unshelled aquatic animals without a vertebral column as:…
A: The question is asking about the classification of large, mobile, unshelled aquatic animals without…
Q: I have this thesis staement but i need more heres the thesis In Valeria Luiselli's "Tell Me How It…
A: Heres the question i need help answering using evidence from the book "Tell me how it ends" by…
Q: Island A A12735131133 22 B 22 C5 || 2 | 108 Island B 12 Island C 114311 32141132
A: Alpha Diversity:-The diversity is represented by showing the number of species in a particular…
Q: Andinomys colombianus is a rat species in colombia that plays an important role in the environment…
A: 1. Biotic Interactions:Distinguish the species that cooperate with Andinomys Colombian us, like…
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: Sugar fermentation (Mannitol): 1. Explain the incubation conditions 2. Explain the reagents being…
A: Sugar fermentation, such as Mannitol fermentation, is a process where microorganisms, such as…
Q: There is a new virus named HANDF that is infecting Cows in the USA. This is a novel virus and the…
A: Gene sequencing, also known as DNA sequencing, is the process of determining the exact order of the…
Q: Which of the following is a reason for the decrease in height with age advancement? Select one: a.…
A: The objective of the question is to identify the primary reason for the decrease in height as a…
Q: GQ5
A: The relationship between DNA sequence, amino acid sequence, and protein structure and function is a…
Q: Determine whether each statement/word/description is true of prokaryotes, true of eukaryotes, or…
A: Within the study of biology, living beings are broadly categorized into prokaryotes and eukaryotes…
Q: What kind of dentition do strepsirhines have? What kind of food do they eat and how do their teeth…
A: Approach to solving the question:1. Define strepsirhines and their dentition.2. Discuss their…
Q: Muhammad ibnu Abdillah, the traditional founder of Islam, recognized all of the following religious…
A: The question is asking which of the listed religious texts was not recognized as sacred by Muhammad…
Q: Note there are no cells on this panel that have a double dose (homozygous) of the K antigen. Which…
A: The K+k- phenotype refers to the presence of K antigen and absence of k antigen on the red blood…
Q: The most common type of leukemia is: Question 8 options: A) CML.…
A: The question is asking us to identify the most common type of leukemia. Leukemia is a type of cancer…
Q: In corn, the genes that determine seed color and coat are both located on chromosome 9. Seed color…
A: This analysis of a corn dihybrid cross revealed that seed color and coat texture are controlled by…
Q: Is rapid antibody testing a form of ELISA? Explain your answer. How is an ELISA different from rapid…
A: The objective of the question is to understand if rapid antibody testing is a form of ELISA…
Q: LH RH LF (B) LH LF Walk RHI RF Trot LH LF RH RF LH RF HI Flexors Extensors -Flexion: -Extension- (C)…
A: Galloping model is mainly wind induced vibration that mainly occurs in overhead transmission lines.…
Q: N 3 13 Which of the following lipid is likely to function as membrane lipid in mammals. O…
A: The objective of the question is to identify the lipid that is likely to function as a membrane…
Q: detail how cation exchange chromatography works and what you would use to elute your target protein.…
A: Cation exchange chromatography is a technique used to separate proteins based on their net surface…
Q: Below is a graphical representation of a survey plot from each island, where icons represents…
A: Alpha Diversity:Addresses species diversity in a particular biological system.It shows the number of…
Q: 2. In dogs, barer trait is controlled by a dominant gene D and the silent trait by the recessive…
A: Question - 2.Note: There is a typing error in the question 2. In the table, under the heading…
Q: If you were educating expecting parents on pregnancy, labor and delivery, as well as the first year…
A: Prenatal Development:1. First Trimester (Weeks 1-12):• During the first trimester, the fertilized…
Q: 1. Complete the table given below regarding the phenotype and genotype ratios in completely dominant…
A: There could be three mode of inheritance. Out of these three, completely dominant mode of…
Q: A baby born 3 days ago presents to the peds clinic slightly jaundiced. The baby is drawn to…
A: The objective of the question is to determine whether the mother should have been given Rhogam 3…
Q: Is there any therapies or drugs targeting on the property of liquid liquid phase separation in…
A: The phenomenon known as liquid-liquid phase separation (LLPS) occurs when components of a mixture…
Q: Match the terms below to the specific virus/prion example that we have discussed in class: prions,…
A: Detailed explanation:Prions:Prions are unique infectious agents composed solely of protein. Unlike…
Q: Which Roman deity was the wife of the second “sky-father”, and the mother of six Olympian gods and…
A: The question is asking for the Roman deity who was the wife of the second 'sky-father' and the…
Q: Describe some ways that drugs might act as enzyme inhibitors.
A: Enzyme inhibitors represent a fundamental class of drugs in the pharmaceutical arsenal, designed to…
Q: What is the term used to describe the situation when many alleles exist for the same gene at the…
A: The question is asking for the term that describes the situation when there are many versions of a…
Q: ستستتثهههس سنهص سنستةسةيةنويد ستستةسةهس ستوسونسموسة Ignore the previous text because I wrote it…
A: The objective of the question is to understand the best way to examine epithelial tissues under a…
Q: Question 22 (iviariuatury/ When E. coli is grown with tryptophan, the transcription of tryptophan…
A: In the case of prokaryotic cells gene expression is regulated by the operon system in which multiple…
Q: (please type answer fast).
A: The objective of this question is to calculate the pH of the solution after a certain volume of…
- Calculate the number of bacteria (CFU/ml) in each serum and saline sample.
- What was the purpose of the saline?
- Which bacteria produced more CFU/ml in serum? Why?
- Provide a possible explanation for the ability of Pseudomonas to colonize mucous membranes.
- Reference(s): Include at least 1 valid reference for your research in correct format (either APA or MLA) (2pts)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- As a medical microbiologist, if you are presented with a patient suspected to have a bacterial disease, describe the various steps you would follow, to establish a laboratory diagnosis. Please keep brief - 8 sentences/dot points max.A patient with AIDS is hospitalized with symptoms of high fever and rigidity of the neck. Routine laboratory tests on the CSF show a WBC count of 100/m L with a predominance of lymphocytes and monocytes, glucose of 55 mg/dL (plasma: 85 mg/dL), and a protein of 70 mg/dL. The Gram stain shows a questionable starburst pattern. Questions: a. What additional microscopic examination should beperformed?b. If the test is positive, what is the patient’s diagnosis?c. If the results of the test are questionable, what additionaltesting can be performedExplain the following tests using Pseudomonas aeruginosa. Describe the purpose, reagents used and the results using Pseudomonas aeruginosa.
- You are working in a lab studying Streptococcus pyogenes as a cause of necrotizing fasciitiis. You have an overnight culture that you want to know the starting concentration of, so do a set of six 1:10 serial dilutions (putting 1 mL from the stock into a 9 mL blank), with tube #1 being 1:10, #2 is 1:100, etc. You plate 0.1 mL from tube 5 onto a blood agar plate and the next morning count 134 colonies. How many bacteria (measured in CFU/mL) were in the overnight culture flask? A. 1.34 x 10^4 CFU/mL B. 1.34 x 10^5 CFU/mL C. 1.34 x 10^6 CFU/mL D. 1.34 x 10^7 CFU/mL E. 1.34 x 10^8 CFU/mL F. cannot tell based on the data given - you'd need to know the volume of the original culture flaskAnswer the following questions: 1. What was the first antibiotic and what was its importance? 2. What does resistance mean? 3. Who is affected by resistance? 4. What if the resistance problem is not solved? 5. Describe the structure of the bacterium (its parts) 6. Can bacteria change? explain 7. Why do Bacteria communicate, what is the purpose? 8. Explain how a bacterium achieves its resistance. 9. What is the use given to antibiotics in production animals? 10. Is this use in animals good practice? 11. Once resistance occurs, what has the scientific community had to do? 12. Do antibiotics only affect negative bacteria? explain. 13. What are the most feared diseases due to antibiotic resistance? 14. Should antibiotics be used against viruses? explain. 15. How can we avoid antibiotic resistance?What is the microbiology laboratory test that Identifies Pseudomonas putida and what are the results of the tests that identify it? please include your sources in MLA. examples are hemolytic tests, lipid concentrations, genomic tests etc.
- Please refer to the given scenario below. What is the most appropriate sample to be collected to isolate the causative agent of the infection? * A 46-year-old male encountered a motor-vehicular accident (MVA) resulting in multiple injuries on his anterior chest and left lower extremities. Aside from the injury, his medical history was unremarkable. The patient was admitted for nine days and underwent debridement and was discharged with an external fixator. However, during his admission, on his 7m post-operative day, the wound was noted to have persistent purulent, bloody discharge from drain site, which is highly suggestive of surgical site infection (SSI). Whole blood Debridement Serum Discharge from drain siteWhat is the microbiology laboratory test that Identifies Pseudomonas plecoglossicida and what are the results of the tests that identify it? please include your sources in MLA. examples are hemolytic tests, lipid concentrations, genomic tests etc.What is the microbiology laboratory test that Identifies Pseudomonas masseli and what are the results of the tests that identify it? please include your sources in MLA. examples are hemolytic tests, lipid concentrations, genomic tests etc.
- At autopsy, the most prominent findings were bronchopneumonia with focal organization and hemorrhage in the right lung. Stains of the lung tissue were negative by Gram, methenamine silver, and acid-fast methods, but Dieterle silver stains revealed short bacilli. Lung cultures yielded Gram-negative bacilli, which grew aerobically on buffered charcoal-yeast extract, but not on blood or chocolate agar. The organisms resembled Legionella, but failed to stain with immunofluorescence conjugates for Legionella pneumophila and multiple other species (L minded, L longbeachae, L gormanii, L dumoffi, L bozemanii). The organism was sent to the Centers for Disease Control and Prevention, where it was eventually identified as a new species of Legionella. What is the most probable source of this man's infection? Family member Water Food Insect Bioterrorism Dark-field microscopy may be used to diagnose spirochetes in which of the following scenarios? To detect spirochetes in the blood of a…What is this organism? And what other test could be done to confirm it's identification? 1.Gram stain - positive cocci, chains Catalase - weak positive Hemolysis - beta BE - positive NaCl- positive Bacitracin - no zone of inhibition PYR - positive Answer: Enterococcus spp. CAMP test to verify the identity 2.Gram positive cocci, chains Catalase - negative Hemolysis - alpha BE - negative NaCl - negative P disk - resistant Bile Solubility - negative Answer - viridans group, Use PYR test to verifyWhy is aseptic urine collection important when cultures are ordered? If you counted 20 colonies from a 0.01-ml inoculum of a 1:10 dilution of urine, how many organisms per milliliter of specimen would you report? Is this number significant? What can you learn from visual inspection of a urine specimen? How would you relate these to the microorganisms present in the sample? How are UTIs acquired/transmitted? Explain why E. coli is frequently implicated in cystitis in females.