Fill out the table with the correct codon, anticodon, and amino acid. Use the table below for MRNA codon to identify the correct amino acids. SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C G A T A T G G T A G A
Q: Is it possible for human beings to undergo asexual reproduction? Why or why not?
A: INTRODUCTION Asexual reproduction doesn't need the fusion of male and female gamete.
Q: Idenitfy the statements whether they are TRUE or FALSE 1. You should use P-20 micropipettes to…
A: INTRODUCTION Spread plate : A liquid broth of bacteria is spreaded on a solid agar suface so that…
Q: What type of gastrulation is depicted from the diagram below? (A) Blastopore Blastopore 4A 4D 4c 4b…
A: The type of gastrulation depicted from the diagram is: Epiboly
Q: Which of the following mammalian structures is derived from one of the extra embryonic membranes?…
A: Introduction An extraembryonic membrane is one of the membranes that aid in embryo development. Such…
Q: How often do forensic anthropologists misidentify race, according to Goodman in the article Race is…
A: Race has been common and technique wherein civilizations divide or categorize people into various…
Q: What type of media are culture medium 1 and culture medium 2? And its difference to each other?
A: Differential media allows growth of different species. This media is used to differentiate between…
Q: Kindly LIST the integumentary organs of the following representative chordates. Please answer direct…
A: Introduction The integumentary organs includes skin, hair, nails and glands. It forms the outermost…
Q: Which technique did Charles Darwin use to measure the age of the Earth? A. rate of erosion of…
A: Charles Darwin has a major contribution to the study of evolution. He gave the concept of "natural…
Q: Directions: Each question below contains two statements of which one or both is correct. Evaluate if…
A: Here i will discuss about covid related questions. Note:- according to bartleby guidelines, i can…
Q: 7. An experimental animal was tested for fatty acids concentration difference on Ist and 30th minute…
A: Fatty acid metabolism is divided into numerous sections since fat breakdown is a complicated…
Q: n the Golgi tendon reflex we see ______________ of the muscle and in the stretch reflex we see…
A: Stretch reflex and Golgi tendon reflex Also called the myotatic reflex which occurs as a response to…
Q: Suppose a species of tulip has three alleles for the gene that codes for flower color. The CR allele…
A: A trait is a characteristic features that is unique to particular individual . In tulip , there are…
Q: Activity 1.4: Essay.Direction: Explain your answer.Today, it is easy to make transgenic plants and…
A: Transgenic plants or animals is a genetically modified organism (GMO) whose DNA has been altered…
Q: Bones can be in different shapes and sizes: There are long bones, short bones, flat bones and…
A: Bones A bone is a rigid organ that makes up the skeleton of vertebrates. These protect various body…
Q: How is the correct balance betweenstem cells, progenitor cells, anddifferentiated cells maintained…
A: The research of structure and function of cell is known as cell biology, and it is based on the idea…
Q: QAO Identify "A" Identify "B" Identify "C" Is this a monocot or eudicot? [Choose ] [Choose ] monocot…
A: The given section is a transverse section of a leaf. It has three major regions: the epidermis which…
Q: Why 3' end should be G and C and 3' should not have more than 3 consecutive G and C?
A: Polymerase Chain Reaction ( PCR) is a technique of making numerous copies of genetic material ( DNA…
Q: The effect of alternative splicing on RNAs and also on the function of tumor suppressor genes (TSG).…
A: Alternative splicing is an RNA molecule modification or splicing process that results in various…
Q: Question about photosnythesis and calvin cycle. The first part of the cycle generates energy in the…
A: Photosynthesis is the process by which plants use sunlight ,water and carbon dioxide to create…
Q: What is gender, why do anthropologists study this topic and why do they call gender a 'cultural…
A: Anthropology is the scientific study of human characteristics. Anthropologists use a wide approach…
Q: How do cells respond to tinygradients of molecules in theirenvironment, as required for knowingtheir…
A: A multitude of communication and actions depend on the gradients around the cell. The gradient of…
Q: E. coli O157:H7 is an organism of concern in contaminated foods. How can the use of MacConkey agar…
A: MacConkeys Agar is a selective and differential culture medium. It specifically select Gram negative…
Q: Bark A B C D E F LL A B Periderm C- D E EF [Choose ] [Choose] Heartwood (2nd xylem) Sapwood (2nd…
A: Meristems in plant roots and shoots are responsible for the plant's "primary growth." These help the…
Q: What are the mechanisms thatallow cell memory to be stored duringdevelopment, explaining how…
A: During development of immune system, when T cells develop, they are as good as nothing. It is later…
Q: Morphogens play a key role in development, cre-ating concentration gradients that inform cells of…
A: Introduction Life starts from a single cell called Zygote. A zygote is formed by the fusion of the…
Q: Why can't there be more than two complementary primers?
A: The two primers used in PCR should not be complementary, or they will anneal to each other and form…
Q: 1. On a hot day a tourist in the wilderness could not find a source of drinking water for a long…
A: a. Vasopressin and aldosterone main hormone which regulates the water and minerals balance.
Q: Hopea Plagata has a transpiration rate of 1.1554 cm³/min while Delonix Regia has 1.8687 cm³/min.…
A: Water is absorbed by the root hair and moves from cell to cell via osmosis until it reaches the…
Q: 1. Give 5 similar species with different characteristics. 2. Give examples on the reproductive…
A: Introduction A species is a group of living organisms that are genetically similar and capable of…
Q: You see a ground squirrel on a prairie in the early spring. You note that he can run quickly and has…
A: Q. - You see a ground squirrel on a prairie in the early spring. You note that he can run quickly…
Q: 6) Identify the most correct choice: a) The first antibiotic ever used was to kill the mold…
A: Answer :- The generation time is the time it takes for a bacterial cell to divide, or for a…
Q: Discuss the effects of the following factors in the rate of cellular respiration: a. temperature…
A: Answer :- The effect of following factors in the rate of cellular respiration are :- * Temperature…
Q: This event of the EMT causes cells to change form, becoming constricted at the apical end (away from…
A: Epithelial mesenchymal transition is very important for the further process of gastrulation,…
Q: What are the major differences between angiosperms and gymnosperms? What are their relationship with…
A: Introduction Angiosperms and gymnosperms are seed-bearing plants that share some characteristics.…
Q: In mammals 40% of the DNA is composed of G-C base pairs, In thermophilic bacteria, the G-C content…
A:
Q: 1 What type of accessory organ is indicated by the #1? What type of accessory organ is indicated by…
A: Introduction The skin is the body's largest organ. The integumentary system is made up of the skin…
Q: How does heterozygote superiority (aka overdominance) differ from underdominance? In your answer…
A: Dominance It is ability of an allele to show its phenotype even in the heterozygous condition, while…
Q: When an organism shifts from a quadriped to a biped, over time what happens to the spine?
A: Quadriped are the animal which have four feet. four-footed, quadrupedal. Biped are the animal who…
Q: In a set-up where Plant 1 and Plant 2 are exposed to light, Plant 1 had a transpiration rate of 1.24…
A: Plants exhibit adaptations to their environmental conditions.
Q: Write a brief explanation of how, by calculating forces and torques in a physical system such as the…
A: Lifting Mechanicss During lifting of an heavy object spine has to support both the weight of the…
Q: about photosnythesis and calvin cycle. The first part of the cycle generates energy in the form of…
A: Photosynthesis is the process occurs in chloroplast of plant cell. By this process plants make there…
Q: a) Exhibit a rotational holoblastic cleavage b) During the second division, the dorsal-ventral axis…
A: C. Elegans is a nematode. The C. elegans life cycle comprises of four larval stages L1, L2, L3, L4…
Q: Space is an example of a density. O Independent / abiotic O Independent/biotic O Dependent / abiotic…
A: The growth of the population depends on several factors. Some of the factors depends on the density…
Q: What is the importance of captive breeding endangered animals in captivity?
A: Introduction :- The process of keeping plants or animals in controlled habitats such as wildlife…
Q: How does cytokinin and auxin interact in the determination of organs in the developing plant embryo?
A: Introduction :- Cell division, shoot initiation and growth, leaf senescence, apical dominance,…
Q: How can soil erosion lead to desertification? It reduces the level of organic matter It promotes…
A: Introduction :- Note :- Since you have asked multiple questions im only answering the ist question…
Q: The contents of ..once released inside the cell can kill the cell. They can also be used to break…
A: Lysosome They are actually membraneous sac filled with Enzymes. They are found in all eukaryotic…
Q: In Methicillin resistant bacteria, what have the bacteria developed that allows them to stay alive…
A: Introduction :- Staphylococcus aureus, is a common form of bacterium that can be detected on the…
Q: Mutations in which of the following types of cells can be transmitted to offspring? * Body Cells…
A: MUTATION
Q: Describe in detail the process of RNAI including the major protein involved. What is the role of…
A: Biotechnology is the field that makes use of biology to solve problems undergoing the making of some…
Can you give further explanations regarding this topic? We are about to tackle this in our next lesson and our teacher assigned us to answer this for practice. But I do not have any idea on how to do this.
Step by step
Solved in 2 steps
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GTranslate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGCComplete the complementary strand: mRNA transcription ATTCGAGGCTAA
- Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTHighlight or underline or bold both the start and stop codons asapIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGUse a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
- In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGThe codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineUsing a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC