5' UTR OP This region is specific sequence surrounding the start codon. OK OS OT 5' and 3' UTR LEU2 KSTP 2μm plasmid DNA Gene of interest 2μm plasmid DNA GAPDI GAPDP SC Cu/Zn-SOD cDNA Amp oriE gene What is selectable gene in this vector? 3' UTR
Q: Opiods cause ligand-gated K+ channels to open and move with their concentration gradient from high…
A: Channel transport is always passive transport, where the movement of ions from higher concentration…
Q: Intro to Neuroscience Question: An individual who has voluntary facial paresis has aberrations in…?…
A: The answer is c. Both their descending pyramidal and extrapyramidal projections from motor cortex…
Q: You discover a new species of reptile that can either lay eggs or have live birth. The species has a…
A: Oviparity is the process of laying eggs, in these types of eggs fertilization can be external or…
Q: Which of the following structures of the heart is responsible for pumping the blood to the lungs?…
A: Heart is the main pumping organ of the body. It is divided into four chambers - two upper atrium and…
Q: guinea pigs, short hair (L) is dominant to long hair (l), and the heterozygous conditions of yellow…
A: Yellow coloured coat genotype- CYCYWhite coloured coat genotype- CWCWCream coloured coat genotype -…
Q: While the majority of the symptoms experienced by people infected with the SARS-CoV-2 (COVID-19)…
A: The presented scenario describes a condition called cyanosis, indicating potential hypoxemia, often…
Q: (Theme 5) AraC is a transcriptional activator that binds to the AraC binding site and is encoded by…
A: The introduction of arabinose into the bacterial culture serves as a trigger for the activation of…
Q: b) Draw how O2 gets out of the leaf. c) Label the name of the structure through which these gases…
A: The first image shows the picture of the internal structure of the leaf. It is a transverse section…
Q: 1. Determine the inheritance pattern for the trait analyzed in the pedigree below. A. autosomal…
A: Inheritance patterns refer to the way genetic traits are passed down from one generation to the…
Q: A substance has a mass of 2.50 pounds (1 pound = 453.59g) and volume of 2.25L (1L-1000 ml). What is…
A: Density is a physical property of matter that describes how much mass is contained in a given…
Q: The plant pigments extracted in the virtual lab that were water soluble were determined to be in…
A: The question at hand involves understanding where water-soluble plant pigments are located within a…
Q: What ARE possible explanations for how these individuals got into the cave? A. The Homo…
A: The question is asking for possible explanations for how Homo naledi individuals ended up in a cave.…
Q: Cleavage and polyadenylation are tightly coupled. What key factor involved in both processes ensures…
A: RNA cleavage and polyadenylation are essential processes in eukaryotic gene expression, particularly…
Q: What is the first change to the cervix that happens called, and what is that change
A: Cervix is tunnel-like female reproductive organ. It is lowest part of the uterus. It connects uterus…
Q: If two organisms mate, then it is guaranteed that one of the offspring will be more fit than either…
A: When two organisms mate, they engage in sexual reproduction, a process that involves the combination…
Q: Organisms must rapidly acclimate to changes in their environment. For instance, temperature changes…
A: Octopus bimaculoides often called "bimac" is an octopus species that belongs to class cephalopoda.…
Q: de is in the left column, and second codon nucleotide is on top. The Mcr1 M and sequences are shown…
A: These tables can be filled by complementary base pairing rule. For example template strand of DNA is…
Q: Which of the following animals uses a tracheal system to breathe? -Insects -Crayfish -Brittle…
A: Breathing can be described as a taking in air rich in oxygen and giving out air rich in carbon…
Q: In your own words, explain one of the following results that happened after a population went…
A: The question is asking for an explanation of the biological and physiological changes that occurred…
Q: dinosaurs walked with an erect, upright stance with their legs and feet under their bodies and not…
A: Lizards and Dinosaurs both are reptiles but Dinosaurs have been extinct. Being reptiles they share…
Q: Which one of the following statements best describes the mechanism by which the "cell cycle control…
A: The question is about the cell cycle control framework, a pivotal biological process that guarantees…
Q: An order was received for 750 mL of 7.5% dextrose solution using 5% D5W and 20% D20W. How many…
A: Dextrose solutions are sterile solutions containing glucose, which is a simple sugar and a source of…
Q: Pine forests tend to have a closed canopy of one or more pine species and relatively little…
A: In research or scientific studies, various types of variables are used, like dependent variables,…
Q: Which is the following graphs, A or B, represents the spirograph of the asthmatic patient after…
A: A spirograph is a test that measures how well a person can breathe. The two important measurements…
Q: Introduction to Neuroscience Question: Which of the following statements about the clinical case of…
A: H.M., whose full name was Henry Molaison, was a patient who underwent bilateral medial temporal lobe…
Q: draw the structure of the polynucleotide GT
A:
Q: words in parentheses. The last answer is a fill in the blank without answer choices. One way that…
A: Dall purpoise is a warm blooded mammal that lives preferably in cold surrounding water.
Q: What skeletal structures behind the mandibular arch in the dogfish appear to be homologous with the…
A: Dogfishes, belonging to the Order Squaliformes, are coastal sharks of 5 feet length. These species…
Q: What are the three types of muscle tissue? Describe the difference between systolic and diastolic…
A: The body receives blood supply from the cardiovascular system. It can regulate the flow and volume…
Q: A bacterial culture is grown using either octadecane (C18H38) or pentachlorophenol (C6HOCl5)) as the…
A: Bacteria can utilize various carbon sources for growth and energy production. The efficiency of…
Q: Restriction sites are palindromic, which means that they read the same in the 5′ to 3' direction on…
A: A palindrome sequence refers to a specific pattern of nucleotides that reads the same forward and…
Q: T/F: Amphibians possess a 3 chambered heart, more advanced kidneys than fish and a liver. -True or…
A: Small vertebrate organisms that can live both in water and land. Frogs, toads and salamander are…
Q: Which of the following phenomenon could possibly explain what happened in a fly whose eye has some…
A: Genetic recombination refers to the process by which genetic material from two different sources is…
Q: Which scenario best exemplifies operant (or associative) conditioning? a raccoon learning to open a…
A: In behavioral psychology, operant conditioning is a sort of learning that entails changing behavior…
Q: The human body plan would be most accurately described as having: asymmetry radial symmetry…
A: Symmetry is defined as when an object or shape can be divided into two or more equal halves by a…
Q: Begin by introducing the topic of asthma, its prevalence globally or in specific regions.Provide a…
A: Asthma is a chronic respiratory condition characterized by inflammation and narrowing of the…
Q: The pH of blood is regulated primarily by the blood PCO2. An increase in PCO2 results in (more?…
A: Hyperventilation is a condition characterized by an abnormally rapid and deep breathing pattern,…
Q: help needed with all of them please A pesticide resistance allele was at a frequency of 50% in a…
A: A population is a group of individuals of the same species inhabiting a specific geographical area.…
Q: Consider Molecule X in the sketch below: protein- ribosome What is the name of X? Your answer should…
A: The Greek term "soma," which means "body," and "ribo," which refers to ribonucleic acid, are the…
Q: Your essay should be prepared and cited using MLA format. Submit your final work as a single…
A: Instruction• Part 1: Using your understanding of DNA technology and evolution, summarize changes…
Q: Why does Dr. Roberts argue that race is a bad proxy for studying an individual’s health and…
A: The objective of the question is to understand Dr. Roberts' argument against using race as a…
Q: One can argue that although the existence of retroviruses represents a complication of Crick's…
A: Retroviruses are a type of RNA virus that have a unique replication process involving the conversion…
Q: What did Neanderthals eat? What plants did they eat and what animals might they have hunted?…
A: The question is asking about the diet of Neanderthals, an extinct species of humans that lived in…
Q: Explain at least one reasonable hypothesis about what caused the extinction of the dinosaurs at the…
A: First dinosaurs appeared in the Triassic period and they were abundant in Jurassic period of…
Q: BLO JUXTAGLOMELLULAR APPARATUS Label the following: Juxtaglomerular apparatus* Granular (JG) cells*…
A: One of the kidney's main structures, the juxtaglomerular apparatus (JGA), is essential for…
Q: GABA is a neurotransmitter that binds to ligand-gated chloride (Cl-) ion channels, causing Cl- to…
A: GABA is a neurotransmitter that plays an important role in the central nervous system. It is…
Q: The dorsal column - medial lemniscus pathway starts with first level neuron in the [Select] [Select]…
A: The Dorsal Column-Medial Lemniscus Pathway (DCML) is an intriguing perspective of our nervous…
Q: Are there any health effects or risks associated with high-altitude adaptations? Explain your…
A: The objective of the question is to understand the potential health effects or risks that are…
Q: What helped our species to flourish and spread throughout the world? A. The demise of the…
A: The question is asking about the factors that have contributed to the successful spread and…
Q: Much of what we know about the human microbiome – the microbial communities associated with various…
A: Health is significantly impacted by the human microbiome, which is made up of many microbial…
Step by step
Solved in 3 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleAlternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5 TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5 46 77 90 5' AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 110 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5' 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3 ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. (i) Identify both the hexameric sequences of the promoter region in the coding strand above.What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is neededCynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letteran opening reading frame is defines by _ 1 absence of highly repetitive sequence 2homology with other species 3a start and stop codon 4placement on a genome map48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.