Q: what are some of the biotechnology approaches are currently being used or being developed for use to…
A: INTRODUCTION The utilization of live creatures or their components in biotechnology involves…
Q: Provide 5 membrane bound organelles and their functions.
A: Introduction : Organelles with a biological membrane around them are called membrane bound…
Q: ------------ of finch populations on the Galapagos Islands allowed species to evolve on each…
A: Introduction :- A species is a group of living organisms that are similar to one another and can…
Q: A 1.5-year-old child developed vomiting, diarrhea, and fever. Stool sample were inoculated into the…
A: Introduction :- Agar is a polysaccharide obtained from red algae that is commonly used as a…
Q: When the mean of a population shifts from one generation to the next due to selection this is called…
A: Evolution: Evolution is the shift in a biological population's heritable traits over successive…
Q: The figure below shows an absorption spectrum of DNA obtained using NanoDrop. Is this DNA…
A: Option B Contaminated with RNA
Q: for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you…
A: Introduction: DNA is a long polymer made up of repeating units called nucleotides. It is the primary…
Q: Sister chromatids are linked together by their centromeres. True or False
A: A condensed form of DNA is known as Chromosome. The main parts of chromosomes include chromatids,…
Q: The long horns on Texas longhorn cattle are an example of - natural selection - genetic drift -…
A: Texas Longhorns are descended from the cattle that Christopher Columbus carried to Hispaniola in…
Q: Contrast how the views differ under high power (40x) and oil immerson (100x) objective lenses in…
A: Compound microscopes provide more clear and better microscopic view of the entities observed than…
Q: You sample the frequency of an allele in a population over 12 consecutive generations and find that…
A: The frequency of an allele refers to the proportion of individuals in a population that carry that…
Q: What is gluconeogenesis? 2. Explain t
A: Introduction: "Disease" is a term used to describe a pathological condition or disorder that affects…
Q: Which evolutionary mechanism is most problematic for endangered species? A. natural selection b.…
A: Introduction :- Genetic drift is a mechanism of evolution that refers to random changes in the…
Q: 2. How can parasites (helminths & protozoa) be possibly spread from an infected person to healthy…
A: The term "parasite" refers to an organism that depends on its "host" in order to survive. Some…
Q: provide a paragraph on sexual dimorphism. discuss why some species have pronounced dimorphism, and…
A: Introduction :- Sexual dimorphism refers to the differences in physical appearance and…
Q: Centromeres of a single homologous chromosome are pulled to opposite poles during
A: Introduction :- Centromeres are a region of a chromosome that play a crucial role in cell division.…
Q: What is the role of the tonsils
A: Introduction : In vertebrates, lymphoid organs, lymphatic vessels, and lymphoid tissues make up the…
Q: What is the expected frequency of Gg while in Hardy-Weinberg Equilibrium if you have an allele…
A: Introduction : According to the Hardy-Weinberg principle, allele frequencies in a population are…
Q: Briefly describe the means we use to classify acellular microorganisms.
A: Introduction : Acellular tissues or organisms lack discrete cells or are incapable of splitting…
Q: 3.565 5.009 7.042 12.340 19.812 22.362 24.736 27.688 29.819 13 14 4.075 5.639 7.790 13.339 21.064…
A: Introduction :- Hardy-Weinberg equilibrium is a theoretical population genetics concept that states…
Q: Using absorbance at 234 nm, 280 nm, and 260 nm, you calculated the percent of proteins present in…
A: Introduction :- A peptide is a short chain of amino acids linked together by peptide bonds. Peptides…
Q: The small figures at the bottom of the figure labeled a-f represent key events in primate evolution…
A: Evolution of steady phenomenon which brings about alteration in life from much simple to more…
Q: 1.Draw a single strand of DNA whose structure can have a 3-nucleotide sequence (codon) displayed on…
A: The DNA contains all the necessary information required for the formation of…
Q: 4. What four main molecular components make up a phospholipid like phosphatidylcholine? (Note: if…
A: Introduction : Organic molecules that are insoluble in water are referred to be lipids. These…
Q: b) What is the pH of each of the following solutions? i) [H] = 0.000001 [H*] = 10-3 ii)
A: Introduction : The measurement of hydrogen ion concentration present in the solution is known as…
Q: Which one of the following supplements has the greatest scientific support Folic acid to reduce the…
A: Supplements can play an important role in maintaining good health and preventing certain health…
Q: Select the structure that depicts L-isoleucine. H➡ C. H➡ COO- H₂C - U 2 CH, | CH₂ COO- H₂N-C-H U III…
A: Introduction : Certain substances can rotate plane polarised light in either a clockwise or…
Q: Are there potential benefits to coconut oil?
A: Coconut oil has gained attention for its health benefits in recent years largely due to the…
Q: Explain weather discuss the effects of ageing on the functionality of T cell Discuss wea
A: Introduction: T cells, also known as T lymphocytes, are a type of white blood cell that play a…
Q: The trait for red hair is recessive (r) to the trait for brown hair (R). What is the probability…
A: Traits in simple terms are referred to as characteristics, these traits are controlled by hereditary…
Q: - what convinces that we are not just on the way but on the 6th mass extinction already? Explain a…
A: An average definition of a mass extinction is the loss of about 75 percent of all species on Earth…
Q: Time (min) 0-10 0-20 0-30 Rate of Diffusion for 1 Crystal (mm/hr) 90 45 36 Rate of Diffusion for 3…
A: Diffusion is a process allowing the passage of molecules inside as well outside the cell to and from…
Q: What structures or features do all protists have in common?
A: All eukaryotes that are not fungi, animals, or plants are categorised as protozoa, or protists.…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: What exactly does "DFR" stand for?
A: INTRODUCTION Flavanoid biosynthetic pathway Pathway that helps in the biosynthesis of flavanoids Eg…
Q: Why would anadromous salmon be considered good indicators of both marine and terrestrial ecosystem…
A: Introduction :- A marine ecosystem is a complex and diverse community of plants, animals, and…
Q: 4 Identify the phylum (or supergroup) to which this organism belongs AND identify its mode of…
A: Phytoplankton are microscopic, photosynthetic organisms that float in aquatic environments and form…
Q: Contrast how prokaryotic cells and eukaryotic cells differ in terms of a) size and b) structural…
A: Cell is the basic structural and functional unit of life. On the basis of structural complexity,…
Q: 5. The solutions in the two arms of the U-tube are separated by a membrane that is permeable to…
A: The net movement of anything (such as atoms, ions, molecules, or energy) from a location of higher…
Q: The following development takes place during the THIRD TRIMESTER a. a yolk sac appears b. a…
A: Introduction : The term "placenta" refers to a vascular structure that forms in the uterus of…
Q: B. BCDwu Label these parts of a skeletal muscle: C. D. E F. 723 Structure of a Skeletal Muscle Bone…
A: Skeletal muscle is a type of voluntary muscle tissue that is connected to the skeleton and under…
Q: Xeris
A: Introduction: Planning a landscape so that it needs little or no irrigation is known as xeriscaping.…
Q: Which of the following statements is true about the above diagram? the signal molecules bind to the…
A: The correct answer is the third option.
Q: At Elmhurst hospital in Queens, a couple originally from the South Indian city of Bengaluru bring…
A: The situation in the waiting room of Elmhurst Hospital in Queens is tense. A couple originally from…
Q: strains of Drosophila that have either normal legs or abnormally short legs and you are studying the…
A: Law of dominance says that dominant character is expressed in two conditions either in homozygous…
Q: Kindly in
A: Introduction: The process of transcription involves copying the genetic data contained in DNA into a…
Q: Draw a phylogeny of living things, incorporating the three domains and the five major subgroups of…
A: Phylogenetics is the study of relationships and the evolutionary history between or within groups of…
Q: Do dinoflagellates push or pull themselves through the water with their flagella? How does this…
A: Dinoflagellates are protists that play an important role in ocean ecosystems, and they possess…
Q: Define genomics, next - generation sequencing, and metagenomics. Create a paragraph that uses all of…
A: INTRODUCTION The genomics, next generation sequencing and metagenomics are briefly explained below.
Q: What type of fungi is typically associated with disease (most likely to be pathogenic)? A mycelium…
A: A broad class of creatures known as fungi includes yeasts, moulds, and mushrooms. They contribute…
!["You have a population with 1 Gg, 1 gg,
and 10 GG genotypes. What is the actual
and expected frequency of the GG
genotype if the population is in Hardy-
Weinberg Equilibrium?"
"0.9, 0.8"
"0.76, 0.83"
"0.83, 0.76"
"0.5, 0.83"
"0.76, 0.95"](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe2a1ef0b-51c8-4819-88dd-b00cf8efbd62%2F758b7b5e-73da-4d99-a2d4-341e2c55281e%2F3x2ivge_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 71 y = 23.397 + 0.65027x 70 69 68 67 66 65 64 66 68 70 72 MidParent height (x) Mean height of adult Offspring (y)The frequency of the A1 allele is p = 0.4, and that of the A2 allele is q = 0.6. The observed genotype frequencies are as follows: f(A1A1) = 0.25 f(A1A2) = 0.36 f(A2A2) = 0.39 Is there a Hardy-Weinberg equilibrium in the population?Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 = [(observed-expected)^2]/expected b)x^2 = sum[((observed-expected)^2)/observed] c)x^2 = sum[((observed-expected)^2)/expected] d)x^2 = sum[(observed-expected)/expected] What is a "p-value"? Group of answer choices a)the threshold at which you will reject the null hypothesis b)the probability of the null hypothesis being false c)the percentage of days you are sick during the year d)the probability of the null hypothesis being true
- Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 = [(observed-expected)^2]/expected b)x^2 = sum[((observed-expected)^2)/observed] c)x^2 = sum[((observed-expected)^2)/expected] d)x^2 = sum[(observed-expected)/expected] What is a "p-value"? Group of answer choices a)the threshold at which you will reject the null hypothesis b)the probability of the null hypothesis being false c) the percentage of days you are sick during the year d) the probability of the null hypothesis being true(1 point) Humans with the genotypes DD and Dd show the Rh+ blood phenotype, whereas those with the genotype dd show the Rh- blood phenotype. In a sample of 400 Basques from Spain, 230 people were Rh+ and 170 people were Rh-. Assuming that this population is in Hardy-Weinberg proportions, what is the allele frequency of the allele D? (a) (a) 0.348 (answer) (b) (b) 0.652 (c) (c) 0.425 (d) (d) 0.575 (e) (e) 0.288 2. (2 points) In the Basque population mentioned above, what proportion of the Rh+ individuals would be expected to be heterozygote? (a) (a) 0.454 (b) (b) 0.789 (answer) (c) (c) 0.516 (d) (d) 0.250 (e) (e) 0.500 How is the answer for #2, b? please explainCompare the 95% confidence interval for the difference between two true means with the 95% confidence interval for an individual true kean. Describe one way in which these two equations are similar and state four ways in which these equations differ.
- The typical tail size for elephants is 150 cm, with a standard deviation of 10 cm. The typical tail size for mice is 7 cm, with a standard deviation of 3 cm. Do elephants or mice exhibit greater variability in tail size? Elephants, because CV = 15 > 2.3 Elephants, because SD = 10 cm > SD = 3 cm %3D Elephants, because = 150 cm > 7 cm O Mice, because CV = 0.43 > CV = 0.07 %3D %3DIn a human population of 1000, 840 are tongue rollers (360 TT and 480 Tt), and 160 are not tongue rollers (tt). What is the frequency of the dominantallele (T) in the population?You perform a chi-square test to compare observed and expected values and obtain a chi-square value of 9.4 with 3 degrees of freedom. What do you conclude? it is not likely that the difference between observed and expected values is due to random chance, since p>0.05 it is impossible to conclude anything from this information it is likely that the difference between observed and expected values is due to random chance, since p>0.05 it is likely that the difference between observed and expected values is due to random chance, since p<0.05 the experiment was done incorrectly and must be repeated it is not likely that the difference between observed and expected values is due to random chance, since p<0.05
- Suppose that you are interested in estimating a population mean. You select a random sample of items, and compute the sample mean and the sample standard deviation. You then compute a 95% confidence interval to be LCL=28.4 - UCL=37.9. So what does that mean? It means that you are 95% confident that the unknown population mean that you are estimating is between the LCL and UCL. So what does that mean? It means that if you were to iterate this sampling process many times, say 100, and calculate 100 confidence intervals, then 95 of those intervals will contain the unknown population mean, and 5 will not. Give me an example of how CI can be used in your work. FYI I work in Endocrinology dept. Specific diabetesCerebellar abiotrophy (CA) is a recessive, genetic neurological disease found in the Arabian horse breed. If the incidence of this disease is about 1 in 400 Arabian horses, estimate the frequency of carriers in a population in Hardy-Weinberg equilibrium. Value of q²: 0.0025 Value of q: 0.05 Value of p: 0.95 Carrier Frequency: 0.095 How many horses would you expect to be carriers for cerebellar abiotrophy if the population consists of 582 Arabian horses? (Round to the nearest whole number and enter 2 digits.)Phenylketonuria is a recessive autosomal genetic disorder that can cause mental retardation. Phenylketonuria is particularly common in Turkey, where 1 in 2600 children are born with the disease. As of 2011, the population of Turkey was 73.6 million. Based on this data, and assuming that the Turkish population is in Hardy-Weinberg equilibrium. (a) Estimate the number of carriers of phenylketonuria in Turkey (b) Estimate the proportion of unaffected individuals who are carriers.
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)