Write a Python program to count the number of lines in a text file. Then, finally print the total number of lines.
Q: Write a Python program that computes the rent in five years and the total rent for one year starting…
A: Given: Write a Python program that computes the rent in five years and the total rent for one year…
Q: Write a Python program that solves the Towers of Hanoi puzzle. Your program should ask the user for…
A: Solution:-- 1)As given in the question it has required the solution with program in the Python…
Q: Write a program that reads a floating point number and prints "zero" if the number is zero.…
A: Please find the answer below :
Q: Write a python program to check if a variable, x, is divisible by 2, 3 or 5. If it is divisible by…
A: The question is to write python code for the given problem.
Q: Write a program that converts temperatures from Fahrenheit to Celsius.
A: #include<stdio.h> int main() { float Fahrenheit,…
Q: Write a Python program which takes a number and prints the digits from the unit place, then the…
A: Write a python program that takes a number and prints the digits in reverse order.
Q: Write a Python program that will ask a user for a number, then determine whether it is odd or even.…
A: Even numbers are those numbers that are completely divisible by 2. Odd numbers are those numbers…
Q: write a python code to roll a dice in such a way that every time you must get the same output number…
A: Use randint method in random module to generate a random number in specified range and a typical…
Q: Write a python program to print without newline. For example you can consider for printing the…
A: Here I have first of all used a for loop to generate numbers from 0 to 20. Next, inside the loop, I…
Q: Write a java program to create a new string of 4 copies of the last 3 characters of the original…
A: Java is the most popular widely used object oriented programming language. It is used as the server…
Q: Write a Python program to count the number of lines in a text file. Then, finally print the total…
A: len is used to find the length of iterable readlines() method will return us the contents in file as…
Q: Write a program that will convert U.S. dollar amounts to Japanese yen and to euros, storing the…
A: Program description: n is the user input integer variable that takes from the user how many dollars…
Q: write a python program to Create a variable containing the DNA sequence: ACGCAGAATGCTTAGGACTAGTTAC…
A: Start Declare a variable dna and initialize value Replace T with U and store it as rna Print middle…
Q: Write a Java program which reads a text file and prints the total number of lines, number of words…
A: import java.util.*;import java.io.*;class Test158 { public static void main(String args[]) throws…
Q: Write a Python program that takes a number from the user and prints the divisors of that number and…
A: The problem is based on findng the divisors of the input value using python programming language.
Q: Write a python program that outputs all possibilities to put + or - or nothing between the numbers…
A: The below given python program will obey the following rubrics: Defining a function,…
Q: Write a python program that iterates the integers from 1 to 50. For multiples of three print…
A: Start for loop runs for 1 to 50 If i is multiple 3 and 7 then print CloudComputting If i is multiple…
Q: Write a python program that accepts the user first name and last name and print them in reverse…
A: Requirements:- Write a python program that accepts the user's first name and last name and prints…
Q: Write a Python program that takes a positive integer from the user and prints the number of digits…
A: Python Program for the above problem
Q: Write a Python program that takes mark of a subject as input and shows grade according to given…
A: mark = int(input("Enter Marks: "))if mark >= 90: print("Grade A")elif mark >= 80:…
Q: Write a Python program that will ask the user two (2) numbers, then infinitely ask the user the…
A: Given:- Pls. add a comment (# this is a comment) on each line or block to briefly explain what it…
Q: Write a program that allows the user to play a simplified slot machine.
A: from random import *import timeimport sys reel_1 = ''reel_2 = ''reel_3 = ''bank = 0current_bet =…
Q: Write a python program that takes 2 inputs from the user, where the first input is a string with…
A: Given: Write a python program that takes 2 inputs from the user, where the first input is a string…
Q: Write a Java program that averages the multiples of 17 for the first two hundred thousand natural…
A: Given:
Q: Write a Python program that takes a number and tells if it is a perfect number or not. [The input…
A: Write a program that takes a number and tells if it is perfect number or not.
Q: Write a Python program that will ask the user to enter a word as an input. If the length of the…
A: Please find the answer below :
Q: Python program that will ask a user for a number, then determine whether it is a prime number or no
A: Write a Python program that will ask a user for a number, then determine whether it is a prime…
Q: Write a program that asks the user for his name and salutes him using it. The prompt must be "What…
A: Given:
Q: Write a program that reads in three numbers from the keyboard and then prints those numbers in…
A: Two questions are asked. So the only the first question will be answered. Please upload another…
Q: write a program that prints all multiples of 5 between 5 and 50 inclusive and then reads a number…
A: Since you have not mentioned any specific programming language, we will solve this question for you…
Q: Write a Program in java to print a string and then don't end the compiling till it get 'Q' Or q…
A: Requirements:- Write a Program in java to print a string and then don't end the compiling till it…
Q: Write a program that works out whether if a given year is a leap year. A normal year has 365 days,…
A: As no programming language is mentioned, it is solved using basic C++
Q: Write a program that takes website names as keyboard input until the user types the word stop and…
A: Given :- Write a program that takes website names as keyboard input until the user types the word…
Q: Write a python program which prints the frequency of the numbers that were given as input by the…
A: Algorithm: Start Initialize an empty list a Initialize an empty dictionary b using while loop read…
Q: Write a Java program that outputs your name, today's date, and five lines of your favorite G-rated…
A: PROGRAM: //Header file import java.io.File; import java.io.PrintWriter; import…
Q: Write a python program that asks the user how many credits they have taken. If they have taken 23 or…
A: Python program Prompt the user to enter the credits they have taken. Store the user entered…
Q: Write a program to read two integers, then test if the two numbers are divisible by (5,6) at the…
A: Write a program to input two numbers and check if both are divisible by 5 and 6 at the same time
Q: Write a Java program to take a string, print a string where for every char in the original, there…
A: Required: Write a Java program to take a string, print a string where for every char in the…
Q: Write a program in python that reads a number and prints all of its binary digits: Print the…
A: Python Program: def DToB(n): if n >= 1: DToB(n // 2) print(n % 2, end=' ')n =…
Q: Write a program that reads an unspecified number of scores anddetermines how many scores are above…
A: Since you are not mentioning the programming language, here we are using Java to complete the…
Q: Task 7 Write a python program that takes 2 inputs from the user, where the first input is a string…
A: ALGORITHM:- 1. Take input string and index from the user. 2. First traverse through the part to be…
Q: Write a python program to convert all time into seconds. And you have to take all these information…
A: Convert days to hours Convert hours to minutes Convert minutes to seconds
Q: Write a program, which prints the following pattern based on the prime number. Suppose we would like…
A: Here is the python code of above problem. see below step for code
Q: Write a program whose inputs are three integers, and whose outputs are the largest of the three…
A: Python code for above: # function to return largest def largest_number(num1, num2, num3):…
Q: Write a python program to print the table of a number that is “1 greater” than the input number. For…
A: Define a function to find multiplication table. The function has parameter to print. Increment the…
Q: Write a program in python to set a same dice on the face every time when the dice is rolled and…
A: Required:- Write a program in python to set the same dice on the face every time when the dice is…
Q: Write a python program to get the calendar of the specific month of a specific year, both of them…
A: PROGRAM INTRODUCTION: Import the required libraries. Take the year from the user. Take the month…
Q: Write a program that takes in an integer in the range 11-100 as input. The output is a countdown…
A: Program Explanation: Import the class for scanner Define a class for countdown Declare and define…
Write a Python
Step by step
Solved in 2 steps with 3 images
- In Python, create a program that meets the following requirements: Take two integers from the user. Save the lower number as x. Save the largest integer as y. Write a loop that counts from x to y by twos. Print out the values of that loop using the Print function in Python. Write another loop that adds x and y, and saves the value as Z. Print out the values of Z using the Print function in Python.Write a program that reads the full name of a student; and then prints it in the form: last first middle initial. Example: Input: Ali Hamad Al-Harbi Output: Al-Harbi, Ali H. Write a program that reads a string composed of three words separated by a space, and then print each word on a separate line. Input: one two three Output: One two threeUse python Write a program that continues accepting user inputs as float numbers until the input is an empty string (i.e., a user press Enter without any typing as the input), and then the program will print the largest number among the inputs. If no input is given, print an empty line. For example: Test Input Result 1 2 WNIO 0 1 2 3 3.0 -1.1 4.4 2.2 3.3 4.4 Answer: (penalty regime: 1, 2, ... %) 1
- Write a program that reads an integer and displays all its smallest factors in an increasing order. For example, if the input integer is 120, the output should be as follows: 2, 2, 2, 3, 5.Write a python program that reads three numbers (integer or floati from the user. finds the largest number between the three numbers, and prints it Note: Use try and except to print an error message if the user enters any string value.Write a program in python that reads an integer and prints how many digits the number has, by checking whether the number is ≥ 10, ≥ 100, and so on. (Assume that all integers are less than ten billion.) If the number is negative, first multiply it with –1. Sample runs of the program are given below: Enter an integer less than 10 billion: 576838 Digits: 6 Enter an integer less than 10 billion: 100000000000 Number is out of range Enter an integer less than 10 billion: 7645362758 Digits: 10
- Write a python program to store 10 students' names and their age. If their age is less than 16 then they are not eligible to apply for driver's licence or else they are. Your program will print the names and age of the two different groups.NEED HELP PLEASE! Write a Java program to read a text file (command line input for file name), process the text file and perform the following. Print the total number of words in the file. Print the total number of different words (case sensitive, meaning “We” and “we” are two different words) in the file. Print all words in ascending order (based on the ASCII code) without duplication. Write a pattern match method to find the location(s) of a specific word (a character string up to twelve characters, e.g. system). This method should return all line number(s) and location(s) of the word(s) found in the file. Print all line(s) with line number(s) of the file where the word is funds by invoking the method of 4). Under each output line indicate the location(s) of the first character of the matched word (refer to the output example below). Empty lines are lines, they also have their own unique line numbers. Repeat the pattern match (4 and 5 above) until user types in EINPUT. A word is…Write an R program that reads the text file into a data frame. Using that data frame, print the mean, median, mode, average deviation, and standard deviation. Be sure to state which output is which, such as “The mean is: 25”. Write a Java program that reads the text file. Using meaningful print statements, output the mean, median, mode, and standard deviation. Write a Python program that reads the text file. Using NumPy and SciPy modules, print the mean, median, mode, and standard deviation. Write an R program that: Reads the text file. Using that data, create a two-dimensional array that is 2,500 rows by 100 columns. Also create a three-dimensional array that is 2500 by 10 by 10. Slice the two-dimensional array using a starting column index of 2 and an ending column index of 5. Print the results of the arrays and slice. Write a Java program that: Reads the text file. Using that data, create a two-dimensional array that is 2,500 rows by 100 columns. Slice the two-dimensional array…
- Write a computer program that calculates and displays to first 100 numbers in the Fibonacci sequence.Use python Write a program that continues accepting user inputs as float numbers until the input is an empty string (i.e., a user press Enter without any typing as the input), and then the program will print the largest number among the inputs. If no input is given, print an empty line. For example: Test Input Result 1 2 0123 3.0 -1.1 4.4 2.2 3.3 4.4 Answer: (penalty regime: 1, 2, ... %) 1 ||Write a program that generates ten random numbers between 1 and 100 (inclusive). All the even numbers among the generated numbers need to be printed. Also, the program needs to count and print the total amount of even numbers generated. [Run your program in Python IDLE to verify if it works correctly as described above] The generated even numbers are: 98 20 12 8 72 The total amount of even numbers: 5