Write a program that prints the number of palindromes in this file ..../englishWords
Q: Write a program to calculate the Factorial of a 5 using a recursive function. Attach the output file…
A: Below is the required code in C++ language. Program Approach: Include necessary header files and…
Q: How to write a function in Python (Pycharm with Pandas) which calculates the total (expressed in MB)…
A: The question is "How to write a function in Python (Pycharm with Pandas) which calculates the total…
Q: use c++ programming language Read two integer number from an input file called input.txt, then add…
A: //include the required header files#include <iostream>#include <fstream>using namespace…
Q: use c code to develop one line of code that reads a full line from a file with file handle fp into a…
A: Answer: fscanf(fp,"%[^\n]",line);
Q: Write a program that inputs a text file, should print unique words in file in abc order, uppercase…
A: 1. Input the file name 2. Open the file 3. Create a list 4. Iterate over the lines in the file…
Q: Musical Key Conversion The chromatic scale is a 12-note scale in music in which all notes are evenly…
A: #converted code def covert(notes,size): scale = ['A', 'A#', 'B', 'C', 'C#', 'D', 'D#', 'E', 'F',…
Q: Function_____________ reads a character from a specified file
A: fgetc() function: It is an inbuilt function used for handling files in the C programming language.…
Q: Write a Python function that implements binary search. The function takes two parameters – a file…
A: def binary_Search(file, value): #function takes filename and value f = open(file, 'r') #open…
Q: In C++ can someone make a code where it reads a txt file and displays the text file that has pending…
A: We have no idea how big the shipping orders txt file is or how much data it contains. As a result,…
Q: ow to read a file and store a specific size from the user in an array of strings in c++? (The file…
A: Summary: hence, we got the output.
Q: For this programming assignment I want you to write a program that calculates bigram frequencies for…
A: Hey there, I am writing the required solution based on the above given question. Please do find the…
Q: For this question please write a basic python code for each point displaying how the concept is…
A: Note: since question contain multiple sub-parts but we can answer only first 3-sub parts at a time…
Q: Language: Python 1. The sample input will have to be in Text File (.TXT) 2. By using the first…
A:
Q: Function___________________ reads a line from a specified file
A: EXPLANATION: The function readline() is used for the purpose of reading the complete line that too…
Q: Mass Write a C++ program that computes density of an object using formula, Volume Create a text file…
A: Hey there, I am writing the required solution based on the above given question. Please do find the…
Q: 12. Fibonacci numbers are the numbers in a sequence in which the first three elements are 0, 1, and…
A: 12.Program:a = 0;b = 1;c = 1;fprintf('First 25 Fiboncci numbers are:\n')fprintf('%i %i %i ', a, b,…
Q: PYTHON without def function Problem Statement Suppose an input file (called "paragraph.txt")…
A: import string # Opening the filefile = open("paragraph.txt") count = 0 # Looping through each line…
Q: complete the function that will return the multipication of 3 given numbers - a,b,c. def…
A: Logic: Product of three numbers is multiplication of three numbers and then store in number After…
Q: (Write a C++ program) This homework is from our textbook page 459 # 16. The Dodgers recently won…
A: #include<iostream> #include<fstream> using namespace std; int main(){ string…
Q: 3. Write a Python function that implements interpolation search. The function takes two parameters –…
A: Interpolation search is an extended form of binary search used to search an element in a sorted…
Q: This is for Python Programing version 3.8.5 - Need a program that uses a text file to store weekly…
A: Program Description: Python program that prompts to enter the name, pays rate, and a number of hours…
Q: Problem Description a) Create a new code cell or a new python file. b) Write a python code that…
A: Given:-
Q: Python - Text Processing Write a function copy(x, y) that can copy a file x into another file y.…
A: PROGRAM: #Defining the copy(x,y) def copy(x, y): #Try block to throw file exception try:…
Q: Assume an input file (called "numbers.txt") contains a number on each non-blank line of the file.…
A: Please find the answer below :
Q: What does the following python code do? f = open("sample.txt", "r") Choose all that apply.
A: Correct answers Are c. reads the file called sample.txt starting from the top…
Q: Write the following function to display three numbers in increasing order:def…
A: PROGRAM CODE: import java.util.Scanner; public class Main { public static void main(String[]…
Q: How would I solve this problem in python language Grades a) Write a program that reads in the names…
A: Program Instructions:Use the open() function to read from the file.Save the result o spilt()…
Q: Case - I: Playing with Digits Write a program which reads input integers from input file which…
A: Required: Required code with comments for explanation and screenshot of both code and output has…
Q: scores.txt : Jan,86 Drew,92 Blake,85 Alex,81 Taylor,88 Jordan ,72 Cam,89 Note: code is written…
A: The answer for the above given question is given blow:
Q: rite python program does the following: Reads a csv file named "train_final.csv" Print the last 100…
A: To read a csv file into a pandas DataFrame, you can use import pandas as pddf =…
Q: Area(): This function receives the values of "s", and "x" then computes and returns the value of…
A: I have provided solution in step.2
Q: use user-defined functions. - use an array of arrays. - use file pointers - use string processing…
A: C is an procedural programming language Developed by Dennis Ritche in the year of 1972 It is…
Q: 1. Write a function in python to count the number of lines from a text file "story.txt" which is not…
A: Explanation: Given data write a python program to count the number of lines from a text file…
Q: Q/in python Open a file and write a program in C++, for example: #include void main { int x int y…
A:
Q: extend the program, the editor(edit) to handle move the cursor down N lines edit :-…
A: It is defined as the short form of LOGical PROgramming. It is a logical and declarative programming…
Q: Write a function that takes a file name to read and then counts the number of words in the file…
A: The solution for the above given question is given below:
Q: Write a function that will read input into an array from a file
A: According to the question below the solution
Q: Python Write a program that requests five grades as input. Your program should drop the lowest two…
A: I have uploaded an image of the code, the code entered and the code output . I provided a commented…
Q: What does the following python code do? f = open("sample.txt", "a") Choose all that apply.…
A: According to the provided information: We need to find out the right option.
Q: Write a function that parses a binary number into a hex number.The function header is:def…
A: Function that parses a binary number into a hex number. The function header is: def…
Q: Read two integer number from an input file called input.txt, then add these two numbers , store it…
A: #include <stdio.h> intmain (){ //creating two file pointersFILE *read, *write; //declare…
Q: program Credit Card Validator - Takes in a credit card number from a common credit card vendor…
A: Program:- #include<iostream>#include<string.h>using namespace std;int main(){ string n;…
Q: In C++ Create a function that takes in an array and outputs the min, max and average of the array to…
A: A function is to be created in C++ that will take in an array and will results with minimum, maximum…
Q: the file Ackermann.cpp. Inside the file the recursive Ackermann function is implemented (described…
A: It is defined as a direct descendant of C programming language with additional features such as type…
Q: Write python code to create a ‘Customers.txt’ file with at least one customer’s record. Write a…
A: Program Approach:- importing "CSV" library for CSV functions function to pay opening the…
Q: struct employee{ int ID; char name[30]; int age; float salary; }; (A) Using the given structure,…
A: Program approach: Include employee structure in program. Declare function prototype. Create a main…
Q: Kevin is a freelance video producer who makes TV commercials for local businesses. When he makes a…
A: file = open('videosTime.txt','w') print('Enter time stamps and enter exit to exit the program')…
Q: In Python 3 I have the working code below it just needs 5 functions. NO import pickle! Write a…
A: In Python 3 I have the working code below it just needs 5 functions. Python code :- Dict = {}…
Python
Topic: Compresion - using functional function
Write a program that prints the number of palindromes in this file ..../englishWords (tips , open file first then read the content before printing)
Step by step
Solved in 2 steps
- Constraints: Use Python Don't use global variables Don't use external libraries (PIL and os are allowed) Start the program with a main function (def main():) Content: Ask the user for an input (an image file). If the file uploaded is not a jpeg/jpg file, print out "Try again!" and ask for an input once more. Continuously ask until a jpeg/jpg file is uploaded. Once a jpeg file is uploaded, create a function with the argument img_info and return a tuple with the image's dimensions in pixels (w, h) and the image data in a form of a list of tuples with RGB values. Print out the values/data collected. Thank you!File Tools View Practical Quiz (Protected Vie PROTECTED VIEW Be careful-files from the Internet can contain viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editin Question 1 Write a python program using for loop which takes from user a choice number. If the choice is less than 10 and then print all the even numbers from 1 to 20 and if the choice is more than 10 print all the odd numbers from 6 to 30.What does the following python code do? f = open("sample.txt", "a") Choose all that apply. Select 3 correct answer(s) Question 15 options: opens a file called sample.txt for reading reads the file called sample.txt starting from the top writes "a" to the file called sample.txt opens a file called sample.txt for appending If the file called sample.txt exists, it writes at the bottom of the file closes a file called sample.txt if the file sample.txt exists, deletes everything in it if the file sample.txt does not exist, it creates the file and opens it for writing
- c# (File of Student Grades) Create a program that stores student grades in a text file. The file should contain the name, ID number, class taken and grade of every student. Allow the user to load a grade file and display its contents in a read-only TextBox.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…profile-image Time remaining: 00 : 09 : 42 Computer Science C++. Need help writing a program that plays the game of Hangman. The program should pick a word (which is either coded directly into the program or read from a text file) and display the following: Guess the word: XXXXXX Each X represents a letter. The user tries to guess the letters in the word. The appropriate response yes or no should be displayed after each guess. After each incorrect guess, display the diagram with another body part filled. After seven incorrect guesses, the user should be hanged. The display should look as follows: O /|\ | / \ After each guess, display all user guesses. If the user guesses the word correctly, display: " Congratulations!!! You guessed my word. Play again? yes/no " Please help in making this code and if possible to include steps to learn what most of the lines and functions do in order to understand it better. Thank you.
- *python coding Driver’s License ExamThe local driver’s license office has asked you to create an application that grades the written portion of thedriver’s license exam. The exam has 20 multiple-choice questions. Hereare the correct answers:1. B 6. A 11. B 16. C2. D 7. B 12. C 17. C3. A 8. A 13. D 18. B4. A 9. C 14. A 19. D5. C 10. D 15. D 20. AYour program should store these correct answers in a list. The program should read thestudent’s answers for each of the 20 questions from a text file and store the answers inanother list. (Create your own text file to test the application.) After the student’s answershave been read from the file, the program should display a message indicating whether thestudent passed or failed the exam. (A student must correctly answer 15 of the 20 questionsto pass the exam.) It should then display the total number of correctly answered questions,the total number of incorrectly answered questions, and a list showing the question numbers of the incorrectly…c++ program need help You are given a file containing many words. Read in all of the words from the file and insert each word into a searchable ADT. Give the user a looping menu allowing them to search for words in the word list. Searches must be be found in O(1) or constant time. Your code must time the search operations, and display the time to the user. For this assignment, you may use the provided word list or another word list with more than 150,000 words. Include this file with your submission. You must design and implement the following classes: Word: This class holds a single word as a string. Basic getters and setters are required. HashTable: This class represents the hash table for storing many words. Main: This is the driver class. The driver: Create a Hash Table Read in all of the words from a text file into the Hash Table Provide a looping menu for the user to perform searches. Time all searches and display the execution time to the user For each search: Prompt…C Programming Write function checkHorizontal to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square to the left or right is a space, stop checking d. If the square to the left or right is the same character as the player’s character, save that it was a flank, stop checking e. If the square to the left or right is not the same character as the player’s character, count the disc f. If the counted discs is greater than zero AND the player found their own character, return the counted discs, otherwise return ZERO Write function checkVertical to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square above or below is a space, stop checking d. If the square above or below is…
- Programming Language: Python 1. Write a Python function that will take two integers from the user as arguments and returns the value of the larger one.What does the following python code do? f = open("sample.txt", "w") Choose all that apply. Select 2 correct answer(s) Question 14 options: If the file called sample.txt exists, it writes at the bottom of the file writes "w" to the file called sample.txt closes a file called sample.txt opens a file called sample.txt for appending opens a file called sample.txt for reading reads the file called sample.txt starting from the top if the file sample.txt exists, deletes everything in it if the file sample.txt does not exist, it creates the file and opens it for writingRest of code in image / This is a bad programming style since it is using goto. // This is an spagetti code and not working.// Use function to display menu, and display game rules,// Use different color for text display.// fix it so it works any way you like./*HANDLE screen = GetStdHandle(STD_OUTPUT_HANDLE); // Write 16 lines in 16 different colors. for (int color = 0; color < 16; color++) { SetConsoleTextAttribute (screen, color); cout << " Hello World!" << endl; Sleep(400); // Pause between lines to watch them appear } // Restore the normal text color) SetConsoleTextAttribute(screen, 7);*/#include <iostream>#include <windows.h>using namespace std;int main(){ //textbackground(WHITE); //textcolor(RED); system("cls"); char ch, a[20], ch2; int num = 100, rnum, guess, count, ch1, c = 0; cout << "**********************************************************"<<endl; cout << "*…