Write a C++ program to calculate a rectangle's area. The program consists of the following function: • getLength - This function should ask the user to enter the rectangle's length, and then returns that value as a double • getWidth - This function should ask the user to enter the rectangle's width, and then returns that value as a double. getArea – This function should accept the rectangle's length and width as arguments and return the rectangle's area. • displayData – This function should accept the rectangle's length, width and area as arguments, and display them in an appropriate message on the screen. main – This function consists of calls to the above functions.
Q: (C PROGRAMMING ONLY) 1. Point Me There by CodeChum Admin I was supposed to be your tour guide but ...
A: To assign the address of the variable to the pointer use & operator. As if & operator is bee...
Q: choose the correct answer A PDA machine configuration (q.w.y) can be *trepresented as (unprocessed i...
A: Question 1: A PDA is defined as a finite machine that has additional stack storage. Its transitions...
Q: ems. Please ans
A: given - The raw bytes below show a directory entry of a FAT12 disk.00002700h: 55 53 51 20 20 20 20 2...
Q: Considering the following scenario: you are tasked with developing a note keeping program that autom...
A: INTRODUCTION: Users can use note-taking software to jot down ideas or notes in a text format. These...
Q: 2. Next Destination by CodeChum Admin Yay! Because of your help, we're now at our first destination...
A: Algorithm: Start Initialize next_destination to 10 Declare 2 integer pointer variables pointer_1 an...
Q: You are asked to write a program to determine if a number is even or odd. Create a pseudocode for th...
A:
Q: which of the following words represent * :palindromes word NOSPACEECAPSON abab NOMELON 123123
A: According to the information given:- We have to choose the correct option.to satisfy the statement....
Q: Which of the following is a challenge for creating dashboards in Excel without the Power BI tools? Y...
A: Dear Student, Excel requires manual compiling of data which will be very difficult for a person to m...
Q: The Word template is used for recording the measurements. Select one: O True O False
A: A Template Group is used for serving a container for multiple Measurement Location Templates and Che...
Q: In the process of deleting rows, columns, and tables, what is one important thing to remember?
A: Introduction: A database is information set up for easy access, maintenance and updating. Computer d...
Q: In the. computer architecture, both data and instructions are saved in same memory. Select one: O a....
A: 1) The Von Neumann is a computer architecture consists of a single, shared memory for programs and d...
Q: 2. Write a JAVASCRIPT program to find the total count of occurrences of the characters j' and 's' in...
A: write a javascript program to find the total count of occurance of the character 'j' and 's' in the ...
Q: Q4: Write a FORTRAN90 program that reads a student ID and his GPA out of 4.0. The program should pri...
A: Algorithm: Start Read student ID and GPA If gpa>=3.5 then print "EXCELLENT" Else if gpa<3.5 a...
Q: What are the conditions under which a VPN between two networks is feasible
A: VPN : VPN stands for Virtual Private Network. VPN is used to create a safe channel for transferring...
Q: How l can read file txt in python
A: By two types we can read file text in python
Q: In this c# program please provide the height (feet and inches) in this program and please show the p...
A: In this question, we are asked to modify the code to that user can able to add height and calculate ...
Q: Determine the reliability between Devices A and B shown in Figure 1. Step-by-step calculations must ...
A: Five - nines Five-nines availability -- or 99.999% -- is the percentage of time a network component ...
Q: How would the class DD be created?
A: There are three interfaces AA , BB and CC. To implement multiple interfaces in java the syntax is ...
Q: Write JavaScript codes to validate a name text field so that when a user submits the form with the n...
A: function validateform() { var name = document.myform.name.value; var Regex =...
Q: What is the boot-up procedure for the router?
A: INTRODUCTION: BOOT-UP: To boot is to power on a computer system and load the startup services until ...
Q: A decision tree with better splits means that it can be more accurate in
A: A decision tree is a graphical model used to represent decisions in a decision-making process. It is...
Q: What exactly is a data race?
A: Introduction: A data race happens when two or more threads in the same process simultaneously visit ...
Q: A number of key elements, such as cost, time, scalability, and sustainability, are taken into accoun...
A: Introduction: It is possible to think of network infrastructure as a collection of interconnected co...
Q: Justifications on why it is vital for software engineers to adhere to SE ethics
A: Introduction: When standards or ethics are broken, individuals commit a range of blunders and act di...
Q: out philippine
A: given - make an informative essay about philippine internet stability.
Q: How can we instruct the computer?
A: Introduction: Additionally, a program is defined as a collection of instructions that accomplish a c...
Q: Write a function named dictMax which takes two arguments: a dictionary and a list. Your function mus...
A: Initialize the return value to None and in the initial value we simply update None with our dictiona...
Q: what needs to be done to get quality software. please do it with your own words
A: NOTE :- Below i explain the answer in my own words by which you understand it well. How you ove...
Q: In system development, a complete and clear software requirements specification might not always be ...
A: User will be having the option to add new items. It can be done by name, expiration date, quantity.
Q: What exactly is HTML?
A: Introduction What exactly is HTML?
Q: What are the binary search algorithm's sole requirements?
A:
Q: Some IT security professionals say their firms should hire ex-computer criminals to find security fl...
A: Introduction : It is critical to establish a firewall for the organization's database and to defend ...
Q: You are a teacher of one programming course and you give to the students one exercise. In this exerc...
A: You are a teacher of one programming course and you give to the students one exercise. In this exerc...
Q: Do composite attributes have the ability to be included in composite keys?
A: Introduction: More than one characteristic may be included in a composite key. Attribute names for e...
Q: Your data warehousing project team is discussing whether to build a prototype before implementing it...
A: I think you should make a prototype. If you want to build a data warehouse, it can be very expensive...
Q: What is the difference between the final, static, public, and private keywords?
A: Step 1) Final keyword Final keyword is one of the reserved keyword in java. It is mainly use to res...
Q: Write the pseudo-code for an algorithm that reverses the order of the elements in an array of size N...
A: An array is the sequential collection of similar elements. The array is a fixed size data structure....
Q: I need to work out a pair of floating point numbers represented by this 24bit 0101 0011 1111 1101 01...
A: Given: Dear student we need to explain about a pair of floating point (real) numbers could be repr...
Q: Computing on the Cloud] What does SLA management entail?
A: SLA: A Service Level Agreement is like a contract between Service Providers or businesses and extern...
Q: In the TFTP protocol: If the client changes its port number on a subsequent connection, but the serv...
A: TRIVIAL FILE TRANSFER PROTOCOL (TFTP): If the client changes its port number on a subsequent connec...
Q: What security policy would prevent unwanted data change and data transfer if there was no encryption...
A: Introduction: EncryptionConfidentiality is guaranteed by the method of transmitting data. A secret k...
Q: Select a single instruction that converts an ASCII digit in AL to its corresponding binary value. If...
A: and al , 0Fh is a single instruction that converts an ASCII digit in AL to its corresponding binary ...
Q: USE PYTHON (GOOGLE COLLABORATORY IS POSSIBLE) Using variables and input functions, make a slambook ...
A: I give the code in Python along with output and code screenshot
Q: Examine any possible connections between utility computing and grid computing and cloud computing.
A: Introduction: GRID COMPUTING is the use of computational resources from various administrative juris...
Q: hello i have a maze and im trying to find a paths in this maze. i want to create a stack and also wa...
A: First, we need to define the four directions. We can define this in terms of coordinates. These coor...
Q: Write C++ code for the following tasks: Write a prototype for the function named fsum() that accep...
A: Note: As per our guidelines we are supposed to answer only one question for multiple questions and f...
Q: show how a switch can be configured to monitor the traffic that passes through it's ports
A: Introduction: In networking, a switch is a high-speed device that accepts incoming data packets and ...
Q: Clusters are effective if their ___________ are maximized. 选择一项: a. None of the answers. b. in...
A: Clustering is the process of grouping similar data instances, called clusters. Clustering groups dat...
Q: Consider the following sequence of transactions: Inputs: 0 Outputs: 25.0-Alice Inputs: 10) Outputs: ...
A: The answer is given below.
Q: With the use of HTML and CSS, create an overlay effect whenever you hover over an image. (a) The ove...
A: In this HTML CSS Development, We have to create a HTML, CSS code which will create a overlay effect ...
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.Code uses C++ language If the user chooses to generate a Pentagono This is a combination of a triangular shape and a square shape -- a symmetrictriangle sits on top of a rectangle.o The triangular shape must be symmetric about the vertical axis. There must beexactly one character in the first line, and the number of characters increases by2 in every successive lineo The rectangle shape must have LENGTH lines of height and all lines are 13characters wide.o Make sure to add delay to view a progressively growing pentagon, otherwise youwill just see the final shape. Code for triangle: for (int i = 1; i <= length; i++) { sleep (1); for (int j = length - i; j > 0; j--) cout << " "; for (int b = 1; b <= i; b++) cout << char(rdm) << " "; cout << endl; } Code for square: for (int row = 1; row <=…C++ programming Chapter(s) Covered: Chapter 1-8 Concepts tested by the program: Working with one dimensional parallel arrays Use of functions Use of loops and conditional statements Project Description The Lo Shu Magic Square is a grid with 3 rows and 3 columnsshown below. The Lo Shu Magic Square has the following properties: The grid contains the numbers 1 – 9 exactly. Each number 1 – 9must not be used more than once. So, if you were to add up thenumbers used, The sum of each row, each column and each diagonal all add upto the same number, Write a program that simulates a magic square using 3 onedimensional parallel arrays of integer type. Each one the arrays corresponds to a row of the magicsquare. The program asks the user to enter the values of the magicsquare row by row and informs the user if the grid is a magicsquare or not. See the sample outputs for more clarification. Project Specifications Input for this project: Values of the grid (row by row) Output for this…
- in c++ Write a program to generate a random number between 1 - 100, and then display which quartile the number falls in. First quartile is 1 - 25 Second quartile is 26 - 50 Third quartile is 51 - 75 Fourth quartile is 76 - 100 To generate a random number, follow these steps: include necessary header files #include <cstdlib> //for random functions #include <ctime> //for time functions set constants for the minimum and maximum values of the desired range const int MIN_VALUE = 1; //minimum range value const int MAX_VALUE = 100; //maximum range value seed the random number generator (RNG) with a unique unsigned int value - system time! unsigned seed = time(0); //system time in seconds since 1/1/1970 srand(seed); //seed the RNG get a random number in the desired range int num = (rand() % (MAX_VALUE - MIN_VALUE + 1)) + MIN_VALUE; The program should: contain header comments as shown in class display a "hello" message (more descriptive than shown in sample)…C++ Visual 2019 A particular talent competition has five judges, each of whom awards a score between 0 and 10 to each performer. Fractional scores, such as 8.3, are allowed. A performer's final score is determined by dropping the highest and lowest score received, then averaging the three remaining scores. Write a program that uses this method to calculate a contestant's score. It should include the following functions: void getJudgeData() should ask the user for a judge's score, store it in a reference parameter variable, and validate it. This function should be called by main once for each of the five judges. void calcScore() should calculate and display the average of the three scores that remain after dropping the highest and lowest scores the performer received. This function should be called just once by main and should be passed the five scores. The last two functions, described below, should be called by calcScore, which uses the returned information to determine which of the…c++ Write a function that will generate a random number between 1 and 100. Then it ask the user to guess a number between 1 and 100. If the user’s entry is equal to the random number, it will display “You are a winner”; otherwise, it will display: “You did not win”
- Lowest Score Drop Write a program that calculates the average of a group of test scores, where the lowest score in the group is dropped. It should use the following functions: void getScore() should ask the user for a test score, store it in a reference parameter variable, and validate it. This function should be called by main once for each of the five scores to be entered. void calcAverage() should calculate and display the average of the four highest scores. This function should be called just once by main and should be passed the five scores. int findLowest() should find and return the lowest of the five scores passed to it. It should be called by calcAverage, which uses the function to determine which of the five scores to drop. Input Validation: Do not accept test scores lower than 0 or higher than 100.Student Registration System is an approach that enables colleges and universities to better supervise a growing number of enrollments. Create a menu system for registration program in c++ that asking an input based on the choices below. If the input is A then the program will ask for name and program (course) store in two arrays, if B then the program will display all the data stored on the array and the program will be terminated only if the input is E. Apply also function on the program: Menu System – 1st Way of Function Add Student – 4th Way of Function Example: REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: A Name: John Lloyd Program: CpE REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: B Name Program…Student Registration System is an approach that enables colleges and universities to better supervise a growing number of enrollments. Create a menu system for registration program in c++ that asking an input based on the choices below. If the input is A then the program will ask for name and program (course) store in two arrays, if B then the program will display all the data stored on the array and the program will be terminated only if the input is E. Apply also function on the program: Menu System – 1st Way of Function Add Student – 4th Way of Function Example: REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: A Name: Sebastian Program: CE REGISTRATION SYSTEM: A - Add Student B - View ALL E - Exit Choose: B Name Program Carlo - CE Sevi - CE
- pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.Coin Toss Write a function named coinToss that simulates the tossing of a coin. When you call the function, it should generate a random number in the range of 1 through 2. If the random number is 1, the function should display "heads". If the random number is 2, the function should display "tails". Demonstrate the function in a program that sks the user how many times the coin should be tossed and the coin then simulates the tossing of the coin that number of times.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…