Q: DNA isolated from Aspergillus has an adenine content of 25%. Based upon this information, what is…
A: It is given that the amount of adenine is 25% in DNA. We need to find the percentage of guanine
Q: In Table 7-1, why are there no entries for the first fourtissue sources? For the last three entries,…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…
A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…
Q: If we digested 4.5 μg of total chDNA with Sal I in a total volume of 60μL and we want to set up a…
A: In polymerase chain reaction or PCR experiments, the precise addition of plasmid vectors and the…
Q: 5. What are the Chargaff's rules? Briefly explain by citing an example.
A: According to Watson and Crick , DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure…
Q: Animal Cell DNA Bacterial cell Plasmid Bacterial 1 3 5 chromosome Questions: 1. Why are plasmids…
A: Introduction The technique of combining DNA molecules from two separate sources and putting them…
Q: 2. You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below:…
A: Hi! As you have posted multiple questions, I will be answering the first two subparts for you. If…
Q: AKS 5a: Use the table below to answer the question that follows. What is the approximate percentage…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA.They also have…
Q: Q2: Answer all of the following questions 1, Define the following terms: a, biotechnology b. Plasmid…
A: Please post these questions separately : Answer 1.) Define the following terms: Biotechnology : is…
Q: estion 15 Genomic annotation O requires STSS O identifies the location and function of genes both a…
A: Gene annotation is necessary because the sequencing of DNA produces sequences of unknown function.
Q: What dose 3'end and 5'end means in DNA and RNA strands?
A: The DNA is double helix structure with two parallel strands running opposite to each other. The RNA…
Q: Organism Tissue % Adenine % Guanine % Cytosine % Thymine Yeast 31.3 18.7 17.1 32.9 Sea…
A: Chargaff’s Rules It was best-known that deoxyribonucleic acid consists of nucleotides, every of that…
Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…
A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…
Q: AKS 5a: Use the table below to answer the question that follows. What is the approximate percentage…
A: DNA or deoxyribonucleic acid is the double stranded DNA that contains sugar and phosphate backbone…
Q: AKS 5a: Use the table below to answer the question that follows. What is the approximate percentage…
A: According to Chargaff's rule, Adenine (A) pairs with Thymine (T) bases through two hydrogen bonds.…
Q: Please ASAP. Thank you. The endosymbiosis theory states that the DNA in chloroplasts and…
A: The theory states how does the eukaryote evolve from prokaryotes. The theory supports evolution.
Q: S SimUText 2019-2020 X File Edit Go Tools Help Recycle Bin Section 1: DNA Structure NOTES 17/18…
A: The following picture depicts a nitrgenous base, a phosphate group and a deoxyribose sugar.
Q: 26. Which of the following are TRUE for plasmid? It is a ring of single stranded DNA. It is found in…
A: Natural selection is the phenomenon in which an organism having heritable variation are selected and…
Q: Conclusions and Future utility about DNA Barcoding and Woolly mammoth diet mystery solved by DNA…
A: As per Your Question We discussed about DNA Barcoding: Answer : DNA barcode is the latest genetic…
Q: Basis of Comparison DNA RNA 1. Number of strands 2. Location in the cell 3. Type of sugar |4.…
A:
Q: ARS-CoV-2 has 30,000 nucleotides? How long is this compared to bacterial genomes and to human…
A: Answer: Nucleotides are the nitrogen containing bases ( adenine, thymine , cytosine , guanine ) ,…
Q: lame Date Class CНАРTER 13 Study Guide Section 3: The Human Genome n your textbook, read about the…
A: These three factors separate each individual from one another and it is what makes them different.…
Q: Application Refer to the table below to answer the following items. Base Percentage Source of DNA…
A: Source of DNA Adenine Guanine Cytosine Thymine Sea urchin 32.8 17.7 17.3 32.1 Salmon 29.7 20.8…
Q: Explain your answer and cite references in APA format. 1. What does mashing do to the fruit? 2. Why…
A: Introduction DNA extraction is a technique for isolating DNA from cell membranes, proteins, and…
Q: Chase and Hershey provided the final evidence that ________. a. nucleic acids exist b. DNA is…
A: DNA and RNA are considered as nucleic acid and they are genetic material of organism too.
Q: Search (Option + Q) Review View Help O Editing v A BIU D Av A =<而< 回三三< ... Question 4 The use of…
A: Genetic material The DNA and the RNA are the genetic material of all living beings. Most of the…
Q: Describe the experiments done by Hershey and Chase That Verified That DNA was the genetic material.…
A: Introduction: Researchers determined that the element responsible for the transmission of features…
Q: 5. A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…
A: A genome is a full set of genetic material found in an organism. Deoxyribonucleic acid (DNA) is a…
Q: Doea DNA Polymerase 3 have any functions outside of DNA replication?
A: DNA polymerase 3 is a complex enzyme that contains ten different polypeptides (alpha, sigma, gamma,…
Q: Statement 1: Gene cloning is a process used to obtain many copies of a particular gene or large…
A: A. This statement is true because Gene cloning is a common practice in molecular biology labs that…
Q: explaination
A: 1.Pneumothorax is defined as the collection of air in the pleural space. Bubbling in the water seal…
Q: 8. List at least 3 ways that recombinant DNA has been used in modern medicine to benefit mankind.
A: Recombinant DNA is a form of DNA constructed in the laboratory. It is generated by transferring…
Q: QUESTION 2: Do DNA fragments move towards the positive or negative end of the gel box? Explain your…
A: Given: Gel electrophoresis is a technique of separating biomolecules under an electric field when…
Q: 21. Which lane shows a digest with Bamtll only? a. I b.I c. II d. IV e. V 22. Which lane shows a…
A: Question - 21. Which lane shows a digest with Bambil only? a.l b. ll c. III d. IV…
Q: 15. Analyze the DNA sequences in the image below. What conclusion can you make about the…
A: Organisms having almost similar DNA sequences share common ancestor. And distantly related organisms…
Q: Age (in years), x Ix log I(x) 1 3 0.43662 2.640103 0.239437 2.379191 3 0.140845 2.148742 4 0.109155…
A: The survivor ship curve are the graphic representation of the number of individuals in a population…
Q: A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…
A: Given Values: The total length of the human diploid genome = 3.2×109 bp The distance covered by the…
Q: Modified True or False. Choose only the letter of the correct answer. 1. Transmission of mtDNA…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…
Q: Source 23.9 24.9 25.2 E coli 26.0 Yeast 313 32.9 18.7 17.1 Sea urchin 32.8 32.1 17.7 184 Rat 28.6…
A: DNA is a nucleic acid that is made up of four nucleotides namely Adenine, Thymine, Cytosine, and…
Q: Hershey and Chase added isotopes to bacteriophage viruses to label the proteins and DNA of the…
A: DNA is the organic molecule that carries information from one generation to another. Several…
Q: 1. What is the principle behind the DNA extraction? 2. Describe the features isolated DNA of…
A: Hi, thank you for posting your question on Bartleby. As per the guidelines, we can answer only one…
Q: True of False 9) Gels are read from left to right. Answer: 10) Functional segments of genes…
A: Gel electrophoresis is a technique which is used to separate DNA fragments according to their size.…
Q: omicron sub variants
A: COVID-19 or Corona virus is an infectious disease caused by the SARS-CoV-2 virus. It affects…
Q: a. Genome Project-write b. Mitochondrial DNA 'Spring Cleaning' c. Micro-encapsulation с. d. Specific…
A:
Q: A light year is approximately 9.46 x 1012 kilometres. Calculate in light years, the approximate…
A: A genome is a full set of genetic material found in an organism. Deoxyribonucleic acid (DNA) is a…
Q: Rev Invest Clin 2004; Vol. 56(1):43-50; Producción de histidasa recombinante de higado de rata;…
A: Purified proteins are vital for a vast range of experimental applications, which include structural…
Q: AKS 5a: How does the approximate percentage of guanine in the DNA genome of E. coli compare to that…
A: In any organism, the DNA of any species follows Chargaff's rule of the stoichiometric ratio 1:1. It…
Q: 9. Describe the effect on the protein chain if base pair #20 in the parent DNA chain is missing. 10.…
A: The majority of living organisms have DNA as their genetic material. The genetic information is…
Q: Draw and Describe the DNA of prokaryotic and eukaryotic cells. Give their differences.
A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…
Write 3 discussion questions about DNA Barcoding and Woolly mammoth diet mystery solved by DNA analysis?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine nucleotides?Please answer fast 1. When a researcher states that two sequences share a conserved region, what principle isinvoked? a. the sequences are homologousb. the sequences are similarc. the sequences share the same functiond. the sequences are homogenous 2. Local sequence alignment algorithms are a better choice than global sequence alignmentfor a. finding homologous DNA elements among distantly related organismsLocal sequence alignment algorithms are a better choice than global sequence alignment b. finding homologous DNA elements among closely related organisms 3. Which of the following sequence alignment programs work by doing local alignments? a. BLASTb. Clustalc. MUSCLEd. T-Coffee 4. The difference between local and global sequence alignments is that local alignmentalgorithms attempt to a. align arbitrary-length segments of the sequencesb. align every residue in every sequenceDNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
- Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answerHi all, If I could have questions 4-10 answered that would be perfect. GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the…MULTIPLE CHOICE QUESTION What are the correct complementary RNA bases for the strand shown here? TUUCTG UAACUG TAACTG TAACTO Rewatch
- 11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1Lab 12- Gel Electrophoresis If provided an image or sample gel, can you use the MMR/DNA Ladder to predict the size (base pairs) of unknown sample bands? If provided an image or sample gel, can you determine if a given individual contains the Alu insertion? If they are homozygous or heterozygous? Know the following concepts and terms: wells, comb, buffer, loading dye, FastBlast What colors are the negative and positive terminals on the electrophoresis chamber? When a gel is placed in the electrophoresis chamber, which terminal should the wells be closest to? What is the charge of a DNA molecule? Which travels faster, loading dye or your DNA samples? Which travels farther, large or small pieces of DNA?Y MULTIPLE CHOICE QUESTION What are correct complimentary bases for strand of DNA shown? O TAACTO ТААССА TAGOTO AATCOA Rewatch O EFT
- Give only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.Answer: giycogen Time left 0:4T:- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. ТAСТАСАСTGTGGTTAАТТААА Oe. АТАТАТАТСGСGTTAAATTCTА CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose... Охуgen Atom ENG سطح المكتبNeed help, please. Please answer the following four questions to the image I attached. 1. You digest both plasmids with BamHI and SacI together (a double digest). What size fragments will result? Please indicate the sizes of the expected fragments in basepairs: The large fragment of pNUT is fragment A. This fragment is expected to be ____ bp. 2. The small fragment of pNUT is fragment B. This fragment is expected to be ____ bp. 3. The large fragment of pPOD is fragment C. This fragment is expected to be ____ bp. 4. The small fragment of pPOD is fragment D. This fragment is expected to be ____ bp.