Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally different mechanisms. Name and briefly describe these mechanisms.
Q: 4) Identify three positions of the patient to obtain a BP. 7) What problems can result from high…
A: Only three subparts can be answered per question as per Bartleby's policy and hence: - (i) Can…
Q: A ADF F D Match the structure given with the name. Acetyl coenzyme A pyruvate Complex V of the…
A: The given structures in the figure are the structures involved in cellular respiration for the…
Q: For each of the ff. scenario, state whether the gene is up- or down-regulated and briefly explain…
A: Histones are proteins that package and protect DNA. They are subject to a variety of modifications,…
Q: Which group of echinoderms has a biradial symmetry and tube feet all over its body?
A: Tube feet is one of the small flexible tubular processes which present in most of the echinoderms…
Q: Question 30 Match the following methods of Analysis: ✓ Lipid anchor is myristic acid and linked to a…
A: Lipoproteins are complex lipids made up of cholesteryl ester and triacylglycerol that are encased in…
Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: 1- "Man is the only real enemy we have. Remove Man from the scene, and the root cause of hunger and…
A: Ecology is the science that deals with the distribution of a number of living species influenced by…
Q: A diploid cell has 6 chromosomes. How many chromosomes are present in this cell in Metaphase of…
A: Introduction There are two types of cell division are found in our body, i.e. mitosis and meiosis.…
Q: 3. Which side of the heart pumps oxygenated blood to the body a. Left side b. Right side
A: The heart is the organ which pumps the blood to the body. The heart is the link between the lungs…
Q: Question 1 Which of the following lipoproteins is primarily involved in reverse cholesterol…
A: Introduction Reverse cholesterol transport is define as a type of mechanism by which excess of…
Q: When a cell goes through Asexual reproduction, e.g. Mitosis, or fission, it creates: O Somatic Cells…
A: Asexual reproduction is a process where an organism creates a genetically identical copy of itself…
Q: 11. Tube the carries sperm from epididymis to urethra during ejaculation. 12. Thick whitish fluid…
A: (According to Bartleby guidelines, only the first three subparts have been answered. Kindly post the…
Q: Describe the mycobacterial cell wall and give one reason why it is important in the treatment of the…
A: Introduction:Tuberculosis (TB), which is caused by the intracellular bacteria Mycobacterium…
Q: Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are…
A: Introduction Molecular biology:- It is the branch of biology that studies the molecular basis of…
Q: E. coli strains diploid for the lac region were constructed by introducing a plasmid carrying the…
A: ANSWER;- I- mutation- repressor is unable to bind to the operator region. If there is no other…
Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughters…
A: The cell division consists of two main steps the division of nucleus and the division of cytoplasm.…
Q: Question 3 "On average, how many amino acids engaged in predominantly hydrophobic alpha- helices…
A: Introduction:- The main chain of a polypeptide when folded in space adopts a conformation called…
Q: select a microbe that has proven to be either environmentally or socially beneficial to human…
A: In this question we have to describe about the useful bacteria . See full answer in step 2.
Q: Which will consume highest amount of 1₂ to become saturated? Which has the highest melting point?…
A: Saturated and Unsaturated fats Saturated fats are those that have single binds between their carbon…
Q: Question 34 Which characteristic is shared by a cell membrane and a chylomicron? Both contain…
A: Introduction:- All lipid molecules in cell membranes are amphipathic (or amphiphilic), meaning they…
Q: With respect to wobble hypothesis all of the following are correct except: An inosine nucleotide in…
A: Introduction According to the Wobble hypothesis only the first two bases of the codon pairs with the…
Q: When looking at a stained cell under a high power light microscope, can one distinguish between the…
A: Introduction Chromosomes are threadlike structures made up of protein and a single molecule of DNA…
Q: Predict the level of genetic activity of the lac operon as well as the status of the lac repressor…
A: There are two regulatory factors present in the lac operon of E.coli These are the repressor…
Q: Identify the INCORRECT match between a situation and whether it is a case of Biosafety, Biosecurity,…
A: Biosafety and biosecurity rules.
Q: Discuss some issues raised involving the biosafety and ecological implications of the field-testing…
A: Genetic modification and biotechnology are two terms that are used interchangeably to describe a…
Q: Epiphytes: Epiphytes have adapted to grow without soil in the canopy layer in a tropical rainforest.…
A: Epiphytes are also known as "air plants" because they are not held on to the forest floor. They grow…
Q: Jessica was trying to solve a problem given to her in class. Help her figure out which produces more…
A: Excretion is defined as the removal of waste products outside the body. The excretion process is…
Q: 2. A well-trained athlete is running 5 km. What is the difference in glucose metabolism in the liver…
A:
Q: What kind of membrane protein is found entirely outside the bilayer on either the extracellular or…
A: Introduction Peripheral proteins are membrane proteins which attach only temporarily to the…
Q: Which of the following statements are characteristics of the aerobic respiration method of making…
A: Please follow step 2 for detailed explanation.
Q: How would the BP of an anxious patient visiting a doctor be different than if the patient is calm?…
A: Normal blood pressure for most adults is defined as a systolic pressure of less than 120 and a…
Q: i) Describe and explain i) the role that flight plays in creating these kinds of viruses, ii) how…
A: Bats are classified into mammals with the order Chiroptera. Bats forelimbs are adapted as a wings…
Q: Some invasive species carry pathogens or parasites with them. Scientists think this might be one…
A: The invasive species terms refer to those organisms which are introduced or are alien species. If…
Q: Lipid absorption involves hydrolysis of dietary fat in the lumen of the intestine followed by the…
A: Lipids are synthesised by the smooth endoplasmic reticulum. For absorption of dietary fats, lipids…
Q: You are being approached by a bear in the woods. Unlike what you may have heard, you do not want to…
A: Autonomous Nervous system The autonomous Nervous system is a division of the peripheral nervous…
Q: Although exposure to both types of radiation can cause DNA damage, ionizing radiation and UV affect…
A: The genetic material in most higher organisms is DNA or Deoxyribonucleic Acid. It is a double…
Q: True or false cytokinesis is the process that divides the chromosomes equally between two daughter…
A: CYTOKINESIS: Cytokinesis is the process in cell division by which, the cytoplasm of a single…
Q: 2. How long would it take for a certain bacterial cell to increase from 1x10² to 1x10²7 when the…
A: Time taken by bacterial cell to increase its number when generation time is 25 min :-
Q: What is the purpose of photosynthesis? * O to convert sunlight into energy. O to convert ADP into…
A: Photosynthesis is the process in plants in which plants prepare food using carbon dioxide and water…
Q: efer to the table below: Saponification Number 179 260 193 185 lodine Number 102 10 111 79 Oil…
A: Introduction Iodine number defined as the number of grams of iodine that are consumed by 100 gram…
Q: 3) Describe the exact location you should place the blood pressure cuff.
A: Location of blood pressure puff.
Q: In a typical insect leg, what part may be composed of 2 to 5 segments? a. Femur b. Trochanter c.…
A: In insects, the legs are jointed and usually have six parts - coxa, trochanter, femur, tibia, tarsus…
Q: Choose the right combination of components required to set up a polymerase chain reaction from the…
A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…
Q: "apoA, apo(a), apoB, apoC and apoE" "apoA, apoB, apoC, apo E, and apol" O "apoB, apoC, apoD, apoE…
A: apolipoproteins are the proteins that bind lipids. These lipids could be in the form of cholesterol…
Q: Biology 1. Which statement(s) is/are most correct concerning the history of epidemiology: a. The…
A: Epidemiology The study and analysis of the occurrence, trends, and causes of health and disease…
Q: Blank are chromosomes with the same genes but potentially different alleles while blank are exact…
A: Chromosomes are thread-like structures that become visible during the process of cell division.
Q: DNA replication involves a
A: DNA Replication: DNA is a self replicating material which carries the genetic information of the…
Q: There are several levels that describe biological organization. Tell me what these levels are and…
A: Cells are the basic building blocks of all creatures, albeit the quantity, shape, and types of cells…
Q: Question 1 Lipids from an organic sample are extracted separately using acetone (A), hexane (H), and…
A: The KHSO4 test is known as acrolein test and is used for fat or glycerol detection. Hexane extract…
Q: In an experiment, the bacteria were placed in dropper bottles containing glycerol as a carbon…
A: The purpose is to kill any previous bacteria on the loop before it is exposed to the bacteria. The…
Within a cell, the complete breakdown of glucose to generate ATP occurs by two fundamentally different mechanisms. Name and briefly describe these mechanisms.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Consider ten glucose molecules that enter a cell. How many ATP can be generated by the complete catabolism of these into CO2 and H2O? If all ten are first incorporated into glycogen, liberated from glycogen, and then fully catabolized into CO2 and H2O, does the ATP tally increase, decrease or stay the same? Consider that 1 UTP = 1 ATP. Explain. Describe the processes which produce ATP and provide a balanced equation of glucose, CO2, H2O and O2Outline the chemical reactions involved in the process of metabolism of one molecule of glucose until it is reduced to its by-products, carbon dioxide and water molecules, with ATP molecules produced in the process. Mention the specific locations in the cell where these chemical reactions involved in glucose metabolism take placea) Explain how in oxygenated tissue your cells use your MITOCHONDRIA to produce energy: DESCRIBE the processes occurring in your MITOCHONDRIA (intermediate stage, Krebs, and ETC), Make sure to mention where those processes occur.b) How many ATP per glucose are formed in your mitochondria? Where are they formed?
- Describe the role that compartmentation plays in the regulation of metabolic pathways. Provide several examples.Indicate whether each of the following processes would be expected to involve the conversion of ATP to ADP or the conversion of ADP to ATP. a) Heart muscle contraction b) transport of nutrients to various locations in the bodyBriefly describe the steps in catabolism of glucose; showing the location where each step happens in prokaryotic and eukaryotic cells.
- Cellular respiration is a metabolic process that breaks down glucose to produce adenosine triphosphate (ATP). Oxygen is an essential molecule to efficiently divert the glucose into an energy-rich molecules needed to sustain activities of the cell. Hence, carbon dioxide and water are the end-products of cellular respiration. The overall process can be refined into three main metabolic stages namely (1) glycolysis, (2) tricarboxylic acid cycle (TCA cycle), and (3) oxidative phosphorylation. In plant cells, the enzymes that catalyze the individual steps involved in respiration and energy conservation are located in highly organized compartment called mitochondrion. In this laboratory activity, you will use the germinated mung beans (Vigna radiata) to demonstrate what happens to the stored sugar in the seed upon its utilization during cellular respiration. At the end of the experiment, you are expected to identify what are the different factors that affect cellular respiration.Discuss the mechanism cells employ to create a concentration gradient to ensure continual uptake of glucose from the bloodstream. Illustrate and Correlate the major Metabolic Pathways that are discussed. Label each pathway.In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose. Glucokinase binds both ATP and glucose, forming a glucose-ATP-enzyme complex. The enzyme then transfers the phosphoryl group directly from ATP to glucose. Select the advantages of phosphoryl group transfer compared to hydrolysis and subsequent phosphorylation? Glucokinase increases the transition state energy, favoring glucose phosphorylation. Reaction intermediates do not need to be present in excess. The process takes advantage of the high phosphoryl group transfer potential of ATP. ATP hydrolysis is thermodynamically unfavorable compared to group transfer.
- Glycolysis is an important pathway for energy production. As such, the enzymes are always present. After eating a meal, blood glucose levels rise drastically, requiring a rapid increase in glycolytic enzyme concentration to metabolize the influx of glucose. When the blood glucose level drops to baseline, the concentration of glycolytic enzymes is reduced in the cell. Question :- Describe one pathway that allows the cell to rapidly increase glycolytic enzyme levels and one pathway that can be used to reduce glycolytic enzyme levels.List the energy pathways of the body and how much ATP each one produces per 1 substrate. HINT: There should be four (two anaerobic and two aerobic).In hepatocytes, the enzyme glucokinase catalyzes the ATP-coupled phosphorylation of glucose. Glucokinase binds both ATP and glucose, forming a glucose-ATP-enzyme complex. The enzyme then transfers the phosphoryl group directly from ATP to glucose. Select the advantages of phosphoryl group transfer compared to hydrolysis and subsequent phosphorylation? ATP hydrolysis is thermodynamically unfavorable compared to group transfer. Glucokinase increases the transition state energy, favoring glucose phosphorylation. The process takes advantage of the high phosphoryl group transfer potential of ATP. Reaction intermediates do not need to be present in excess. Incorrect