With relevant examples where possible, illustrate the classifications of infectious diseases

Q: How many ATPs are there in this triglyceride? Showing NADH and FADH2 calculations and steps

A: Triglycerides broken down into glycerol and three fatty acids containing  12, 16 and 14 carbon atom…

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Plasmid DNA In contrast to a cell's chromosomal DNA, plasmidsare tiny, circular, double-stranded DNA…

Q: interpret constructively the given iris scatterplot below

A: The iris is the colored part of the human eye. Muscles in our iris control our pupil that is the…

Q: using the knowledge of policy making to come up with a solution to the  ebola outbreak  of a…

A: An epidemic occurs when an infectious illness expands fast and affects a significant number of…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: Liliana is preparing chemically competent cells for heat shock transformation from old batches of…

A: i) E. coli DH5alpha is suitable to propagate plasmid before protein expression. It is a versatile…

Q: There are several lines of evidence that suggest that chloroplasts and mitochondria were once…

A: For performing independent life, energy production is very much important. Some organisms depend on…

Q: Describe the steps of DNA replication.

A: Introduction:  DNA replication means replicating or producing two same replicas of DNA from one…

Q: 18. The amino acid sequence is matched with three bases on mRNA codon or DNA codon (pick one). 19.…

A: Please follow step 2 for detailed explanation.

Q: At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous…

A: Answer : Due to the resonance nature of the purine and pyrimidine bases, nucleic acid strongly…

Q: what ways to modify food and kcal intakes to achieve beneficial physiological changes

A: Beneficial physiological changes : Physiological changes in day-to-day life and activities that can…

Q: Drag each of the following events to the location where they occur in a eukaryotic cell Nucleus…

A: Introduction  The process through which a gene's information is used to produce either RNA molecules…

Q: Explain the procedure for 2 hour post prandial testing and oral glucose tolerance testing . Give the…

A: The postprandial glucose blood sugar test can be prepared for in one of two ways. The first…

Q: What strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging…

A: A crucial part of astrocyte physiology and function is Ca2+ signaling. Ca2+ imaging is the most…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: Species that have undergone higher rates of change (long-branched taxa) tend to be linked…

A: LBA (long branch attraction) is a type of error wherein the distinctly related species are shown as…

Q: Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are…

A: Introduction :- A cloning vector is a short bit of foreign DNA that can be injected for cloning…

Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…

A: DNA structure formation

Q: Explain your results when observations as stated below were obtained after the plasmids were…

A: DNA is a polymer composed of two polynucleotide chains that coil around each other to form a double…

Q: Consider the following scenario: Molecule X is highly concentrated outside of a cell membrane.…

A: The transportation of molecules across the plasma membrane depends on their concentration gradient…

Q: Name two traits that primates have that are modified from an ancestral mammalian form (consider:…

A: Primates usually come under mammalian order and is divided into two sub orders prosimians and…

Q: 2) List the names of the two major Contractile Proteins. Which of the proteins is "bound" and…

A: 2 Given that it is composed of two phospholipid layers, the plasma membrane is known as a…

Q: Genetically modified foods (GM foods) are products produced from organisms that have had genetic…

A: Crops that have had their DNA altered through genetic engineering are referred to as genetically…

Q: Question:- Why do gametophytes not give rise to spores in bryophytes or ferns?

A: The life cycle of plants show alternation of generation in which the plant body alternates between a…

Q: Northern blot is an analytical technique commonly performed to study gene expression in experimental…

A: A tissue is defined as a group of cells that possess a similar structure and perform a specific…

Q: Discuss briefly strategies employed by bacteria to develop resistance to antibiotics. Cite one…

A: Antibiotic resistance mechanisms include natural resistance brought on by an impermeable membrane or…

Q: You are part of a group of researchers examining the survivorship and fecundity of Bengal Tigers…

A: Animals are illegally poached all over the world for fun or for their body parts. Over the last…

Q: 32. What are the two components of tRNA which are important for building a protein? what are…

A: Ribosomes are the one of the most essential organelle which is known for synthesis of proteins.…

Q: A Transporter A Transporter B B Transporter C O Transporter D C D Electrochemical gradient: Which…

A: Sodium-dependent glucose cotransporters, also known as sodium-glucose linked transporters (SGLT),…

Q: SUBPHYLUM CRUSTACEA Describe the joint motion of the crayfish cheliped (first walking leg). Compare…

A: Introduction :- The characteristics of a crustacean include: a segmented body with a hard exterior…

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA has the ability to self replicate. It undergoes semi-conservative replication. DNA Replication…

Q: the function of the cell membrane and pathogenicity of covid.

A: What are the Function of the cell membrane and pathogenicity of SARS-Cov2

Q: Convert to cDNA and add linkers

A: This is the High-throughput sequencing that has become the  revolutionary technique for the…

Q: Overview of Cell Signaling Pathways Q7.2: A first messenger molecule activates a receptor that…

A: Cells receive and respond to signals from their surroundings. This is accomplished by a variety of…

Q: What is apoptosis? Explain cell signaling pathways that triggers it.

A: Introduction :  A multicellular organism's life cycle includes a crucial process called cell death.…

Q: I need help finding a plan and listing a plan  in chronological order for the top down approach for…

A: Introduction-- outbreak investigation steps Step 1: Prepare for field work. The numbering scheme…

Q: the main characteristics of genetically encoded calcium indicators: (can be more then one answer)…

A: Main characteristics of Genetically encoded calcium indicators (GECI) are-

Q: What do the terms “chains, clusters, pairs, and tetrads” refer to in the arrangement of bacteria?

A: Bacteria generally multiply via binary fission and results in two identical daughter cells. These…

Q: B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: We know that Immunity is resistance to disease. The two important components of immunity are innate…

Q: Complete ventricular filling occurs during what phase of the cardiac cycle? a. when the atria are…

A: The heart is the part of circulatory system. It pumps blood to various parts of the body.

Q: is the PCT because it has the "brush border" B is the glomerulus A is the Distal Convulated…

A: The parts mentioned in the micrograph are the parts of nephron. Each nephron is the smallest…

Q: Include some background on ethanol fermentation (i.e. biochemistry, factors that affect…

A: Yeast is a single-celled fungus that most likely developed from a multicelled progenitor and…

Q: To be considered invasive, a species would likely have population growth rates (r) in the introduced…

A: Population growth rate : Population growth rate is the rate of change  in the population, in a given…

Q: Explain mechanisms of action in endocrine signaling, taking Adrenalin-induced fight or flight…

A: A complicated system of glands and organs makes up the endocrine system. Body's metabolism, energy…

Q: 5. What process is happening in each of these instances: hydrolysis or dehydration synt a. Amylase…

A: 1. Hydrolysis - The primary job of amylases is to hydrolyze the glycosidic linkages in molecules of…

Q: 2. In fruit flies: At the b locus, + = normal color b = black body At the v locus, + = normal wing v…

A: An individual expressing a dominant trait could have two copies of the dominant allele (homozygous…

Q: Recommend an international strategy for Drip Footwear to consider

A: Introduction: Drip Footwear is not merely a brand of sneakers. It is a company whose mission is to…

Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…

A: Introduction  All cell membranes that exchange lipids and proteins are included in the endomembrane…

Q: 1) Using Punnett Squares, determine which genotypes are possible at each gene locus if you cross…

A: Mendelian inheritance describes specific patterns of how features are passed down from parents to…

Q: What two important characteristics allow us to identify a cell in interphase?

A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…