Q: Which molecules regulate cross-bridge attachment activity? O a. tropomyosin and M lines O b. calcium…
A: The Muscular System is a vital physiological system that humans require in order to exist. This…
Q: The International Union for the Conservation of Nature and Natural Resources (IUCN), has declared…
A: Some of the conservation strategies adopted by wildlife conservation in the Philippines are the…
Q: SSBS are: A single-stranded bodies called Okazaki fragments. B substrates for DNA ligases. ©…
A: The biological information flows through genes. DNA is the main genetic material of most of living…
Q: The mechanism of activation of eukaryotic genes involves addition and removal of phosphate residues…
A: The eukaryotic system has a general trend of activating anything by phosphorylation and vice versa.…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: Rice Malze Wheat Millet Sorghum 05 cereal crops provide 60% of the food energy taken in by the…
A: Cereal Cereals are the kind of grass that are cultivated for their grains.
Q: Which of the following is/are the contents of the dorsal body cavity? A. heart and lungs B. brain…
A: Introduction - The cranial cavity, which houses the brain, and the spinal cavity, which houses the…
Q: Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action…
A: Voltage gated Na+ channels :- It play an important role as a regulatory for cellular excitability.…
Q: Why are parasitic infections of nematodes still common despite our understanding of their biology?…
A: The parasitic can reside in the human body's small intestine. They reproduce by laying eggs and…
Q: When the gene tree differs from the species tree due to the gene having great genetic variability,…
A: The genes are the main part of the DNA which helps in the regulation of the body function by the…
Q: МАРPING Xmal 611 bp 70 bp 575 bp EcoRI 673 bp 1,283 bp Xmal & EcoRI (double digest) 611 bp 62 bp 708…
A: Restriction Mapping It is a technique involving the cutting and digestion of DNA sequences with the…
Q: All of the following are functions of connective tissues, except energy and mineral storage.…
A: Introduction Tissue is a collection of cells with similar structures that work together as a unit.…
Q: According to the current scientific understanding of the topic, why is our gender identity is NOT a…
A: Gender identity can correlate with a person's assigned sex or can differ from it.In most…
Q: Mark has an autosomal recessive condition called sickle cell anemia, a serious blood disorder that…
A: Sickle cell anemia is an autosomal recessive disorder which ne it can only expression if present in…
Q: ructures commonly present in all vertebrate kidneys?
A: Vertebrates have the following variation of the kidneys: - Pronephros Mesonephros Metanephros
Q: E Which choice best describes the location of the majority of the musculo-skeletal system? A. It is…
A: Introduction Bones, muscles, tendons, ligaments, and soft tissues make up the musculoskeletal…
Q: Select the best description of permease activity in the following environmental conditions.
A:
Q: Briefly summarize the conventional wisdom (DNA mutation theory) of the cause of cancer. Discuss the…
A: It proposes that successive DNA mutations in a single cell cause cancer (monoclonality). This…
Q: A 3-point test cross produces the following numbers of offspring: + + a 348 How many double…
A: Test cross is a cross made between f1 (offspring)with its recessive parent to identify the dominance…
Q: Which part of a cell allows nutrients and other material to enter or leave the cell ?
A:
Q: Neurotransmitters are released from a neuron when the action potential reaches the end of its axon.
A:
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: Compare the cells in the two photomicrographs below in terms of their shape and structure(s). А B
A: *pictomicrographs shows the photograph of objects under a microscope. * objects like metal and…
Q: For genotype: repP¯ lacP lacP* lacO* lacZ* lacY Select the best description of permease activity in…
A: A) Permease activity:- Lactose Present; Glucose Present-- 4.lower than basal. Lactose Present:…
Q: 8. Objective lens X has a limit of resolution equal to 0.2 mm while objective lens Y has 30 pm. a.…
A: Resolving power It can be defined as the ability of the objective lense to distinguish between two…
Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…
A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…
Q: Identify the sex glands in both male and female. Then briefly describe how the nervous system and…
A: there are eight major endocrine glands scattered throughout the body, they are still considered to…
Q: What is the World Health Organization recommendation for the prophylaxis of rheumatic fever after a…
A: Rheumatic fever:A illness that can develop as a result of strep throat or scarlet fever that has…
Q: Microorganism A was exposed to different constant temperatures to get the specific D- values.…
A: The Z-VALUE is the boom or decrease in temperature required to lessen or increase the decimal…
Q: 1. Substances move through biological membranes against concentration gradients via: a. Simple…
A: *simple osmosis is spontaneous passage of water through a semipermeable membrane * Active…
Q: discuss the potential role of soy phytoestrogens in cancer.
A: Plants often produce various metabolites to support their life. These primary and secondary…
Q: Do genes or alleles independently assort?
A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Describe how a product generated from glycolysis can be used for ATP production by the electron…
A: * Glycolysis is a metabolic pathway it converts glucose into pyruvic acid and in this process free…
Q: 1. requires ATP A. diffusion 2. random movement of molecules from high to low B. facilitated…
A: Diffusion is the movement of molecules from a high region to a low-concentration area via random…
Q: a. The scale of a spectrophotometer extends from 1 to 100% T, what are the values of these two…
A: Ans a. Absorbance of these two extremes from percent transmittance ( %T) can be calculated by the…
Q: Human genome includes its chromosomes and plasmids. O True O False
A: Introduction A genome can be defined as an organism's complete set of deoxyribonucleic acid (DNA).…
Q: ___ refers to the collection of all alleles across all gene loci in a population. a) Genetic drift…
A: Introduction :- An allele is a variant form of a gene. It is found on a certain chromosome at a…
Q: Calculate the coliform concentration in a milk sample based on the following colony counts: 10 2 :…
A: Introduction Coliform bacteria are defined as rod-shaped Gram-negative non-spore forming and motile…
Q: What is pecten and what is thought to be its function? 2. Please describe the typical hunting…
A: Note- As per Bartleby rules, we are supposed to answer only first three questions. Kindly repost The…
Q: The study of the b-globin gene helped establish the one gene-one polypeptide relationship. Which of…
A: Mutation is a random process. It leads to change the nucleotide in a sequence of a gene.
Q: What are the methods for the clinical diagnosis of β- thalassemia, from the findings how can a…
A: The thalassemias can be broadly characterized as α- or β-thalassemias, depending on the defective…
Q: The VPg protein from picornaviruses has which of the following function? O a. It packages the viral…
A: Picornaviruses are viruses that infect fishes, mammals, and birds. These group of viruses are…
Q: Question 7: How could immunotherapy be used to kill superbugs and how would this therapy distinguish…
A: The immune system checks the body for infections or problem-causing chemicals and fights any harmful…
Q: Bat/Hedgehog/??
A: MERS is also called Middle East respiratory syndrome. It is a contagious, sometimes fatal…
Q: Do phylogenetically proximal species have cells with proximal chromosome counts?
A: Introduction - The idea of phylogenetic species (PSC) The idea of a species as an irreducible group…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: need a good answer.with explanation.Thanks 1- Which of the following species appeared earliest in…
A: 1- Which of the following species appeared earliest in the fossil record? Choices ( Homo…
Why is it important to wash fruit? Explain it detail
Step by step
Solved in 2 steps
- E. Is there an advantage of dry fruits over fleshy fruits? Give reasons.Identify the floral characteristics of Citrofortunella microcarpa (calamansi): Aestivation of calyx- ______ Aestivation of corolla- _______ Number of carpels- ____ spiral or whorled- ______ Form/type of ovules- ______Mature fruits have a high respiration rate. True or false ?