Which of the following statements regarding the Urinary system is INCORRECT? Select one: O a. The kidneys are responsible for urine production and are located in the posterior portion of the abdominal cavity on either side of the vertebral column. O b. The suprarenal glands are also called the adrenal glands which lie upon the superior poles of the kidneys. O c. The medial border of each kidney presents the hilus which marks the entrance into a c. cavity called the renal pelvis. O d. The cortex of the kidney lies at the periphery of the organ and the medulla lies internal to the cortex. Next pa

Q: the cardiac cycle (More than one answer may be correct. Choose all that apply) a.) stroke volumes a...

A: The cardiovascular system is also called the blood vascular or circulatory system, which consists of...

Q: Define gap junction

A: Cell Junctions are a class of cellular structures consisting of a complex protein that provide adhes...

Q: Define supination

A: Supination can be defined as the rotational movement that occurs in the forearm and hand in such a m...

Q: Define optic nerve

A: The eyes are complex sense organs. They gather information about the environment; and the brain inte...

Q: Define efferent

A: Kidneys are a center of blood purification and urine formation. They are responsible for the circula...

Q: Define maximal stimulus

A: The stimulus is the change in the structure of an organism induced by the electrical signals or impu...

Q: Which of the following technologies is best suited for identifying this disorder? Select one: a. D...

A: Aneuploidy is the presence of an abnormal number of chromosomes in a cell, for example a human cell ...

Q: Define septum secundum

A: The cardiovascular system is also called the blood vascular or circulatory system, which consists of...

Q: Define synapse; pl. synapses

A: The neuron is the fundamental functioning unit of the brain, a specific cell that transmits informat...

Q: Renal/Resp 4 Unanswered The myogenic regulation response in the kidney to low systemic blood pressur...

A: The circulatory system involves the circulation of nutrients and blood from the heart to the tissues...

Q: 1 20 ORI 40 60 3' TTCGAGCTCTCGTCGTCGAĠATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAGCAGCTCT...

A: The first five amino acids encoded by the gene are : thymine thymine cytosine guanine  adenosine

Q: Antiseizure drugs stop seizures from happening by inhibiting electrical impulses. What is the import...

A: A seizure is a sudden, uncontrolled electrical disturbance in the brain. It can cause changes in you...

Q: What is referred pain, and how is it useful in diagnosing internal disorders?

A: Referred pain is also called as reflective pain. The definition of referred pain by Anderson is- Pai...

Q: Define red marrow

A: Bones are the most important component of the skeletal system. They are hard calcareous structure be...

Q: Define growth hormone (GH)

A: The endocrine system involves the slow transmission of hormones from the endocrine glands to the tar...

Q: how hyperprolactinemia induces amenorrhea and galactorrhea

A: The endocrine system is made up of a network of endocrine glands and chemical messengers produced by...

Q: Define neoplasm

A: Cancer is the title given to a collection of related infections. In all sorts of cancer, a few of th...

Q: Describe the gross anatomical features and function of each region of the respiratory tract, the ple...

A: Respiratory system is the system that helps in the breathing. It includes respiratory tract, lungs a...

Q: What effect does calcitonin have on the bone?

A: The internal framework of the human body is known as the human skeleton. 270 bones make up the human...

Q: Define lipase

A: Lipase is an associated protein the body uses to interrupt down fats in food in order that they may ...

Q: Define lactation

A: Hormones signal the mammary glands in the body to begin producing milk to nourish the baby.

Q: Define relaxation phase

A: When the muscle relaxes the tension decreases. This phase is called the relaxation phase. During thi...

Q: Define emphysema

A: Normally, when we breathe, air passes slowly through the trachea into bronchi and smaller tube bronc...

Q: 12

A: Homologous chromosome can be defined as the pair of a chromosome that is identical in length, staini...

Q: Define depolarization

A: The difference of potential across the cell membrane creates a polarization in the membrane. All the...

Q: Remember that hexose kinase is an enzyme required for hexose metabolism, a process that takes a 6-ca...

A: Respiration is an important phenomenon, that is composed of three main events, namely glycolysis, Kr...

Q: Which of the following statements are true regarding the fovea centralis of the eye? A) 100% cones ...

A: Eye is an organ of sight. Eyes are composed of an optical portion, which focuses the visual image on...

Q: Define pericardium

A: In most mammals, the heart is a muscular organ that pumps blood into the circulatory system's blood ...

Q: Define appendicular

A: Anatomical terminology is the form of scientific terminology used by anatomists, zoologists and heal...

Q: Define renal column

A: Kidneys are a center of blood purification and urine formation. They are responsible for the circula...

Q: How is factual (declarative) information represented and organized in long-term memory?

A: Anything you recall that happened more than a few minutes ago is considered long-term memory. Long-t...

Q: What specific function does each of the four types of teeth perform in the oral cavity?

A: The oral cavity is the point of entry in the gastrointestinal system. The oral cavity is responsible...

Q: Define physiologic contracture

A: Muscles are the largest delicate tissues of the musculoskeletal framework. Muscle is inferred from t...

Q: Define nucleic acid

A: Any material or substance that is found in the nucleus, cytoplasm, and mitochondria of an organism o...

Q: The giant panda has a diploid number of 42, which includes a pair of sex chromosomes that is analogo...

A: A sex-determination system is a biological system that determines the development of sexual characte...

Q: Define mesencephalon

A: The Nervous system consists of the brain, spinal cord, sensory organs, and all of the nerves that co...

Q: Define embolism

A: Blood vessels are conduits that distribute blood throughout the body tissues. Blood vessels form 2 c...

Q: The capillaries of skeletal muscles are of the structural type called __________ .

A: Blood is carried through the body via blood vessels. An artery is a blood vessel that carries blood ...

Q: Define fundus

A: Organs are composed of tissues. These organs consist of certain specialized structures which aid in ...

Q: True or false. The gender of the individual is female and the condition is Tripo-X.

A: Triploidy is a rare chromosomal abnormality in which fetuses are born with an extra set of chromosom...

Q: proper explanation

A: The cardiovascular system also known as circulatory system or blood vascular system is responsible f...

Q: What happens to rods if they are constantly exposed to light?

A: Rods are the photoreceptor cell present in the retina of our eye and are very sensitive towards the ...

Q: Filtration at the nephron occurs from the to the Use anatomical names for nephron structures, not fl...

A: The kidneys are the renal system's principal functioning organ. They have paired structures located ...

Q: Define limbic system

A: The human brain is the primary organ of the human nervous system. The brain is made up of the cerebr...

Q: Define vitamin D

A: Biological molecules that are present in living organisms and are involved in various biological pro...

Q: Define thrombocytopenia

A: Thrombocytopenia is defined as an occasional blood platelet count. Platelets are irregular, disc-sha...

Q: Define residual volume

A: The respiratory system is the network of organs and tissues that help you breathe. It includes your ...

Q: Define corona

A: A virus is the smallest sort of parasite to exist, usually extending from 0.02 to 0.3μm in size, alt...

Q: Define tensor tympani

A: The filaments of myofibrils are known as myofilaments. These are principally composed of proteins kn...

Q: True or false. The gender of the individual is female and the condition is Tripo-X.

A: Triploidy is a rare chromosomal abnormality in which fetuses are born with an extra set of chromosom...