Which of the following regarding RNA secondary and tertiary structure is false? A-minor motifs involve a ssRNA-dsRNA interaction where the polyA chain interacts with the minor groove of the dsRNA helix The hairpin loop is stabilized only by pi-stacking, and is critical for t-RNA in order to display the anticodon bases RNA secondary structure is derived from base pairing interactions, not backbone interactions A pseudoknot is a type of coaxial stack between two discontinuous helices derived from SSRNA-SSRNA interactions Coaxial stacking is the alignment of two helices separated by a broken backbone, and stabilized by pi-stacking between the terminal base pairs of

Which of the following regarding RNA secondary and tertiary structure is false? A-minor motifs involve a ssRNA-dsRNA interaction where the polyA chain interacts with the minor groove of the dsRNA helix The hairpin loop is stabilized only by pi-stacking, and is critical for t-RNA in order to display the anticodon bases RNA secondary structure is derived from base pairing interactions, not backbone interactions A pseudoknot is a type of coaxial stack between two discontinuous helices derived from SSRNA-SSRNA interactions Coaxial stacking is the alignment of two helices separated by a broken backbone, and stabilized by pi-stacking between the terminal base pairs of

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 9RQ: How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3? a. 0 b....

See similar textbooks

Similar questions

What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
Which of the following regarding RNA secondary and tertiary structure is false? Coaxial stacking is the alignment of two helices separated by a broken backbone, and stabilized by pi-stacking between the terminal base pairs of the stacked helices The hairpin loop is stabilized only by pi-stacking, and is critical for t-RNA in order to display the anticodon bases RNA secondary structure is derived from base pairing interactions, not backbone interactions A pseudoknot is a type of coaxial stack between two discontinuous helices derived from ssRNA-ssRNA interactions A-minor motifs involve a ssRNA-dsRNA interaction where the polyA chain interacts with the minor groove of the dsRNA helix
AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q
The palm domain of poliovirus RdRP contains a GDD motif. Explain why changing D (Asp) in the GDD to alanine produces an inactive polymerase that can no longer copy RNA templates. (changing protein fold is not enough) G= Glutamic acid D: Aspartic acid
The structure of the transfer RNA assumes a more 3-dimensional structure because of the hydrogen bonding in far apart bases in the structure.
Explain in Biochemistry concepts like folding, and amino acids, enzyme reaction of MPro enzyme in connection to its role with the COVID-19 virus. asap please.
In Plasmodium, describe the processing of lysyl-tRNA synthetase transcript, by including the localization within the cell, any processing and packaging in general. Any particles that bind to the mRNA molecules, exchange, any membrane to cross, any functional groups to be added
Here is a partof the mRNA sequence of the spike glycoprotein of the SARS Covid-19 virus, starting with the start codon. A deletion was found in 6 bp (underlined). How will this change affect the polypeptide sequence? >S_protein AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACGUGGUGUUUAUUACCCUGACAAAGUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUA
How long would the peptide be that is translated from this MILNA sequence: 5-AUGGGCUACCGA-3? a. 0 b. 2 c. 3 d. 4
Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’
The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. 5′ and 3′ ends of at least one RNA molecule