Q: Examine the following pedigrees. Which is the most likely mode of inheritance of each disorder? (a)…
A: When both parents are normal and offspring is affected then it can be either autosomal recessive or…
Q: For that same genotype: In the presence of molecule A, what functional structural proteins are…
A: Introduction Gene is a functional unit of DNA. It carries all the information of a organism. Gene…
Q: Which coat protein is involved in transport of vesicles from the trans-Golgi network to the plasma…
A: Introduction Proteins are huge, complex molecules that play a number of important tasks in the human…
Q: The same DNA sequence as in Questions # 2-4 is rewritten below (Sequence #1). Sequence #2 is the…
A: Gene mutation is the abrupt change in amino acid coding sequence , critically bringing alterations…
Q: respiration and fermentation occurring in yeast cells; what are these metabolic activities and how…
A: *Respiration is a metabolic process in which living cells obtains energy in the form of ATP by…
Q: Examine Figure 3. Based on the number of taxa, which 2 vertebrate clades suffered the most…
A: An extinction event is rapid decrease in the biodiversity on Earth. Extinction is death of species…
Q: What environmental factors affect the affinity of Hb for oxygen? Which way do they shift the…
A: The red blood cells are specialized to carry oxygen . So they contain lots of molecules called the…
Q: The figure below illustrates partial models of a starch molecule and a cellulose molecule, two…
A: Introduction The carbon compounds present in living organisms are collectively known as…
Q: If microorganisms penetrate the innate defenses, neutrophils - activates the complement system. O…
A: The immune system's primary sources of histamine are mast cells and basophils. Along with other…
Q: Love the One You're With There are six known species of lizard that can reproduce both sexually and…
A: The organism's or an environmental group's atmosphere is the combination of physical, biological,…
Q: impact to patience of isolating T cells from blood sample (magnetic beads coated with CD4/CD8…
A: T cells help B- cells to make antibodies, they belong to the immune system called adaptive immune…
Q: Aspirin inhibits cyclooxygenase enzyme. This enzyme makes the prostaglandin hormone type your…
A: INTRODUCTION Thromboxane This is a hormone that plays an important role in platelet aggregation,…
Q: Be able to describe how blood flow and pressure are affected blood vessel size (radius). Know the…
A: The volume flow rate of blood (Q) is related to pressure difference (P)∆ and resistance to blood…
Q: inducible operon
A: Transcription: The process of copying of a segment of DNA into RNA is known as Transcription. The…
Q: 18. In warm water, a fish with Hb-2 could not perform as many reactions requiring oxygen as could a…
A: An adaptation is a characteristic that allows an organism to adapt to its surroundings, survive, and…
Q: generated from this gene. Be sure to appropriately label the ends of the molecule.…
A: Introductions Transcription is the DNA based gene expression, DNA segment will be copied…
Q: which of the following is NOT a step in rod phototransduction by rhodopsin? activation of rhodopsin…
A: In rod phototransduction a cascade of signalling involves G protein, transducin, and…
Q: which of the following statements about heterotrimetric G proteins and their receptors is incorrect?…
A: What is G Protein? The G protein is a type of protein that is present in the cytoplasmic region of…
Q: Do mRNA levels increase or decrease as DNA methylation increases?
A: DNA is a molecule that is composed of two strands of polynucleotides. It stores genetic information…
Q: An insect from a strain breeding for white eyes (RRww) was crossed to an insect from a strain…
A: When an organism is heterozygous, it has two distinct alleles of the same gene. For instance, pea…
Q: How does intron splicing work? Draw the mechanism. Label the branchpoint and lariat structures.
A: Introns are the non-coding regions of a DNA or an RNA sequence, whereas, the exons are the coding…
Q: Meselson-Stahl first cultured bacterial E. coli cells in a medium containing N15 (heavy nitrogen)…
A: DNA is a double helical structure that has two DNA strands. These strands separate during the…
Q: place the following lists into the most appropriate pairs and explain how they are correct
A: Photosynthesizing organisms like plants, cyanobacteria, and green algae undergo photosynthesis to…
Q: As electrons move through the electron transport chain of photosystem II, they lose en- ergy. What…
A: In photosystem II, the reaction centre chlorophyll a absorbs 680 nm wavelength of red light, that…
Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…
A: A separation technique known as electrophoresis relies on the movement of charged species in a…
Q: Suppose you are a production manager of a pharmaceutical company, now you are assigned to formulate…
A: The world's biggest preventable reason for death is tobacco usage, which results in cigarette…
Q: 1. What sex chromosome combination does a female have? 2. What sex chromosome combination does a…
A: Disclaimer: - According to BNED guidelines, only the first 3 fill in the blanks questions can be…
Q: Differences in body form among modern humans are likely the result of: long term genetic…
A: A species goes through a series of changes during evolutionary processes and either adapts to its…
Q: hypothalmus
A: Introduction A gland is an organ that produces one or more things, such as saliva, milk,…
Q: Starting as a lipid in some holiday prime rib, trace the path that energy and biomass make as that…
A: Triglyceride molecules are the most common form of fatty acid storage and transit within cells and…
Q: What are the units of absorbed dose? What are the units of Biologically Equivalent Dose?
A: Ionization occurs when radiation strikes and knocks electrons off an atom, resulting in charged…
Q: What are the formulating ingredients used in nicotine chewing gum? Please answer at your own easy…
A: Nicotine chewing gum is used for the cessation of smoking habit. It helps to decrease the withdrawal…
Q: EVOLUTION LINK Explain some of the evolutionary implications that one can conclude from mice and…
A: Introduction Heritable traits—the hereditary features of an organism—change over the course of…
Q: Not all animals have organ systems or even organs. What are the advantages to having specific…
A: the animal doesn't contains organ and organ systems are knows as unicellular organism. it contains…
Q: A scientist tries to harvest bacterial cells by centrifugation; he used an RPM of 5000. If the…
A: Centrifugation is a process in which molecules are segregated out at high speed but as different…
Q: Quadrat-Based Estimates The simplest description of a plant community in a habitat is a list of the…
A: abundance is the relative representation of a species in a particular ecosystem. It is usually…
Q: 16. In cold water, natural selection would favor heterozygotes that expressed Hb-1 and Hb-2 at the…
A: The sequence of nucleotides in DNA leads to gene. It encodes a particular peptide. There are two…
Q: A glucose monitor is an instrument that diabetics use to check their blood sugar. To use it, you…
A: In the pamphlet, standard deviation is shown to be 0.2mg/ml. This means that 68% of the readings…
Q: You are experiencing some hearing loss. You don’t work with loud machinery or go to loud concerts.…
A: The specific degree of pressure change caused by a noise is measured by the sound pressure level,…
Q: What type of cell can launch their receptors as antibodies? O Helper T cells O Macrophages Killer T…
A: An antigen can be referred to as a substance that prompts the body to produce a particular immune…
Q: 5. In the absence of mutation, the heritability of neck length in a population of giraffes would…
A: Evolution refers to the change of characteristics of a population that can be inherited from one…
Q: 1. a) List 5 distinguishing factors of reptiles and their similar characteristics to birds. b) How…
A: Birds and reptiles are two different groups of animals that are quite different from each other yet…
Q: please give an evolution timeline about dogs. (7 keypoints please) Please use the format below
A: The domestic dog, also called as Canis familiaris or Canis lupus familiaris, has earned the title of…
Q: 1 a. explain briefly, Insects and freshwater fish are both categorized as animals. Describe how the…
A: 1 a. The respiratory system's principal job is to eliminate carbon dioxide and give oxygen to the…
Q: 1. A 43-year-old male presented to the emergency department (ER) with complaints of fatigue, night…
A: (A) As lung lesions are found in the patient, sputum is the most important sample for this patient's…
Q: The transcription factors that bind to enhancer sequences are known as _____. A) regulators B)…
A: Proteins called transcription factors attach to DNA-regulatory sections, which are typically found…
Q: The bacterium Agrobacterium infects plants and causes plant cells to develop tumorlike cellular…
A: In the wild, the A. tumefaciens wild type causes "crown gall disease," which is characterized by the…
Q: Does chromatin compaction increase or decrease as DNA methylation increases?
A: DNA methylation favours the heterochromatin state and reduces overall DNA flexibility while…
Q: Question 4 For recessive X sex linked traits, females can be O afflicted with the disorder. a…
A: Generally, males are affected with recessive X sex linked disorder as males have only one X…
Q: what happens to CO2
A: Hemoglobin: It is a protein found in the red blood cells which is comprised of 2 α and 2 β subunits…
68.
Step by step
Solved in 2 steps
- The following is true about epigenetic gene control: O epigenetic changes to the chromatin may result from childhood development epigenetic changes to the chromatin may result from chemicals in the environment O epigenetic changes to the chromatin may result in cancer O An example of a chromatin change is DNA methylation that prevents gene expression from that area of the DNARefer to the following illustration to answer the question. O protein A is not made because it is normally required for its own transcription TRANSIENT SIGNAL TURNS ON EXPRESSION OF PROTEIN A What is protein A? O a maintenance methyltransferase O a histone PAY O a cell type-specific gene regulator a HAT (histone acetyltransferase) any of the above PAD the effect of the transient signal is remembered in all of the cell's descendantsEpigenetic phenomena involve DNA methylation and histone acetylation genetic mutation chromosomal rearrangements gene inversions
- Which of the following is true about epigenetic modifications? -Epigenetic modifications always repress transcription -Epigenetic modifications are irreversible -Epigenetic modifications only occur on the tails of histone proteins -Epigenetic modifications influence the relationship between DNA and histone proteinsHow does epigenetic regulation differ from other forms of gene regulation? OIt is easily reversible. O It can regulate multiple genes at once. O It is the least energetically expensive. O It forms a physical barrier to prevent transcription. O It can be inherited by somatic daughter celsEpigenetic marks regulate gene expression. Which epigenetic mark is NOT associated with positive gene expression? Histone acetylation Histone Methylation De-methylated DNA Methylated DNA
- What is the abbreviated name of the human gene that contains the following sequence CAGATTGTGAAGAGGTCTCTTGA? ATR HBB XPA FGFR3 IDS XRCC1 p53 F8 APC ERCC3Match the following changes with the correct responses. (Some answers may be used more than once. Some answers may not be used.) Deacetylation of histones Methylation of cytosines a single nucleotide polymorphism, where adenine may be present instead of cytosine phosphorylation of cytosines is an epigenetic change that is an epigenetic change that [Choose ] is an epigenetic change that results in decreased gene transcription is not an epigenetic change ✓ is an epigenetic change that results in increased gene transcription is an epigenetic change that could either increase or decrease gene transcriptionWhich of the following are ways in which transcriptional repressors can function in eukaryotes? (Mark all correct answers) Competition with an activator for binding to an enhancer Recruit co-repressors that prevent the RNA Pol II complex from binding the promoter Sequester activators outside of the nucleus Recruit co-repressors that cause heterochromatin formation
- Which of the following statements about the control of genes involved in galactose metabolism in yeast is FALSE? Choose one of the answers below The genes coding for enzymes acting in the gal system are organized in an operon. The system involves a transcription activator. The system involves a transcription repressor. The presence of galactose sequesters the repressor in the cytoplasm. none of the aboveWhat is the role of general transcription factors? GTFs bind to enhancers or silencers and regulate transcription GTFs bind to the core promoter and allow transcriptional initiation GTFs are cis-acting regulatory sequences GTFs regulate the length of the mRNA GTFs are part of the RNA polymerase II holoenzyme, and control transcription initiationWhich of the following statements about the control of genes involved in galactose metabolism in yeast is FALSE? The genes coding for enzymes acting in the gal system are organized in an operon. The system involves a transcription activator. The system involves a transcription repressor. The presence of galactose sequesters the repressor in the cytoplasm. none of the above