What would be the effect on DNA replication of mutations that destroyed each of the following activities in the DNA polymerase I? 3' - 5' exonuclease activity 5' -3' exonuclease activity 5' -3' polymerase activity

What would be the effect on DNA replication of mutations that destroyed each of the following activities in the DNA polymerase I? 3' - 5' exonuclease activity 5' -3' exonuclease activity 5' -3' polymerase activity

Name: What would be the effect on DNA replication of mutations that destroye
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What would be the effect on DNA replication of mutations that destroyed each of the following activities in the DNA polymerase I?3' - 5' exonuclease activity5' -3' exonuclease activity5' -3' polymerase activity

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0
Based on what you have learned with respect to various DNA repair pathways, decide the most appropriate pathway that would be used to repair the following types of DNA damage. Explain your reasoning. A change in the DNA sequence caused by a mistake made by DNA polymerase during replication In a fungal species, pyrimidine dimers induced as a result of UV exposure A double-stranded break that occurs during G1 and prevents completion of DNA replication
DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase Sliding Clamp Single Stranded Binding Protein Primase
DNA polymerase I has 5'-3' polymerase activity, 5'-3' exonuclease activity, and 3'-5' exonuclease activity necessary for DNA replication. Mutations in the gene that encodes DNA polymerase I may cause the enzyme to lose these activities. Match the consequence of a loss-of-function mutation in DNA polymerase I to the corresponding lost activity. Lost 5'-3' polymerase activity no RNA primer removal during DNA replication no double helix denaturation Lost 5'-3' exonuclease activity Answer Bank decreased polymerase fidelity Lost 3'-5' exonuclease activity no DNA synthesis to fill gaps caused by removing RNA primers unstable strand separation within the replication bubble
Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 Next
Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I is produced. What will be the most likely consequence of this mutation? The DNA would not exist in a supercoiled state. There would be no RNA primers laid down. The DNA will not be able to unwind to initiate replication. The DNA strands would contain pieces of RNA. There would be no DNA replication on the leading or lagging strands.
Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase, Polymerase, Helicase, Topoisomerase 1.Unwinds DNA at the replication fork. 2.Makes and reseal breaks in the double-helical DNA to release the torque that builds up as a result of unwinding at the replication fork. 3.Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA nucleotides. 4.Removed RNA primers and replace them with DNA. 5.Joins Okazaki fragments.
The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
Describe precisely the catalytic activity of DNA polymerase I that removes RNA primers. 3' to 5' exonuclease 5' to 3' exonuclease 5' to 3' endonuclease O 3' to 5' endonuclease
Which of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the above
Match the enzymes involved in DNA replication with their function. Primase [ Choose ] [ Choose] Synthesizes short RNA segment to initiate new DNA strand Helicase Main enzyme that extends RNA primer by adding DNA nucleotides to it Stabilizes single-stranded DNA Relieves over-winding of DNA ahead of the replication fork Removes RNA primers preceding Okazaki fragment and replaces RNA nucleotides with DNA nucleotides Single-stranded binding proteins Unwinds DNA helix Synthesizes the ends of the linear chromosome Seals nicks between adjacent DNA segments DNA polymerase III [ Choose ] DNA polymerasel [ Choose ] DNA Ligase [ Choose ] Topoisomerase [ Choose ]
What role do the following enzymes play in DNA replication? DNA polymerase Helicase DNA ligase