Give detail explanation of what pathologies are involved in A woman has been trying for a baby without success. Link the technologies: Hormonal stimulation Intrauterine insemination (IUI) And (in vitro fertilisation)

Give detail explanation of what pathologies are involved in A woman has been trying for a baby without success. Link the technologies: Hormonal stimulation Intrauterine insemination (IUI) And (in vitro fertilisation)

3-2-1 Code It

6th Edition

ISBN:9781337660549

Author:GREEN

Publisher:GREEN

Chapter6: Icd-10-cm Outpatient And Physician Office Coding

Section: Chapter Questions

Problem 12MC

See similar textbooks

Related questions

Q: Question 25 Which of the following would you expect to see when comparing the genomes of two…

A: Our genome is made up of about 3 billion base pairs of DNA that make us who we are. DNA sequences…

Q: The presence of bile salts in the colon will stimulate the salt transport activity of the crypt…

A: Diarrhea has long been linked to excess bile acid in the colon and small intestine lumens. Previous…

Q: Mitogens tend to ___________ Select one: a. suppress cell division b. promote cell division c.…

A: The process by which a parent cell divides into two daughter cells is known as cell division.…

Q: When can we say that HIV has progressed to the stage of AIDS? List several signs and explain why…

A: HIV or the Humans Immunodeficiency Virus is a virus that affects the immune system of individuals…

Q: Suppose a lysosomal protein escapes into the cytosol; it will then become ___ of the cytosol Select…

A: Introduction: Proteins, nucleic acids, carbohydrates, and lipids can all be subdivided by a wide…

Q: true or false: Telomeres are necessary so that genes at ends of prokaryotic DNA are not lost due to…

A: Telomeres in human cells are specialized structures at the ends of chromosomes which serve to…

Q: Ch. 6: When the body senses hypoxemia or high carbon dioxide in the blood (hypercapnia), it would…

A: Hypoxemia is defined as a decreased amount of oxygen in the blood. It can be caused by a variety of…

Q: does human contain supercoiling DNA？Why supercoiling is important and what is it？

A: A higher-order DNA structure is described by DNA supercoiling. Two complimentary strands are wound…

Q: Which of the following produces EPSP? OA. GABA acting on GABAA receptors O B. GABA acting on GABAC…

A: Introduction Excitatory postsynaptic potentials (EPSPs) are postsynaptic potentials in neuroscience…

Q: Ch. 5: All of the following can arise from lower respiratory tract infections EXCEPT: a)…

A: The correct answer is option c. Epiglottitis. All of the given conditions can arise from lower…

Q: Describe characteristics of Proteus Vulgaris in the Agar: Blood Agar MacConkey Agar EMB PEA Mannitol…

A: Non-human bacteria, viruses, and fungi outweigh human cells, making our body a home and source for a…

Q: B-cells participate in _______ immunity and produce ________. Select one: a. innate, proteasome…

A: B cells or B lymphocytes, which are produced from bursae, are important components of the adaptive…

Q: Which of the following is a function of this nucleotide: 3' H O 011-0 0 Guanine H OH O Acts as a…

A: Solution :- A nucleotide is an organic molecule with a basic composition of a nitrogenous base,…

Q: can you answer in 5 simple statement please

A: Robert Koch in the 1890s gave 4 postulates to identify whether a specific microorganism is…

Q: Geographic variation in the poison arrow frog Ranitomeya imitator illustrates that natural selection…

A: ANSWER) Poison frogs have developed adaptations in their skin by which they secrete toxins in their…

Q: Mucolipidosis type X is a lysosomal storage disease that was suggested to be a result of impaired…

A: Lysosomal storage disease is mainly detected by a blood test using a substrate called 4-…

Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…

A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…

Q: Which of the following statements regarding the nitrogenous base guanine is FALSE? A) ALL of these…

A: Guanine is one of the important bases in the category purine.

Q: Ch. 5: "Blue bloater" patients are most likely to suffer from: a) emphysema b) asthma c) chronic…

A: A patient with persistent bronchitis was once referred to as a "blue bloater." Due of the…

Q: Find an image of a function in Biomathematics. How is function applied in Biomathematics?

A: In contrast to experimental biology, which deals with conducting experiments to support and validate…

Q: Elaborate on the abbreviation RTP. What does it stand for? What is it used for?

A: We all know the contribution of proteins in our body.Now it may help in getting energy.Proteins can…

Q: AT =C/G B. Quantitative geneticists are interested in identifying the number of genes contributing…

A: A) DNA is grouped into nitrogeneous bases called purines and pyrimidines, Purines are Adenine (A)…

Q: What are the variables of Fried's Scale?

A: "Physical fitness is essential in our everyday lives, it benefits us in so many ways and makes us…

Q: B-cells participate in _______ immunity and produce ________ a. acquired, proteasome…

A: Immunity mediated by humor is mediated by B lymphocytes. The B cell transforms into a plasma cell,…

Q: When a protein becomes phosphorylated, it _________ a phosphate group. This reaction is mediated by…

A: Some of the energy is utilized to generate ATP from ADP and Pi, but ATP is required immediately for…

Q: Which of the following statements regarding retroviruses is FALSE? A) a cellular enzyme converts…

A: Normally virus can have genetic material as either RNA or DNA. Retrovirus is a type of virus which…

Q: Which of the following statements regarding transduction is FALSE? A) transduction reduces genetic…

A: A virus moves its genetic information from one bacterium to another through a process called…

Q: why the therapeutic effect takes weeks to manifest while side-effects occur immediately in tricylic…

A: Depression and anxiety are significant disorders that frequently need medical treatment. Anxiety is…

Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…

A: Restriction enzymes cut the DNA at specific sites called restriction sites.

Q: Does a positive, negative, neutral, or zero ΔG associate with cellular facilitated transport?

A: ANSWER) Facilitated transport is the passive method of transport which is generally spontaneous and…

Q: apply the knowledge of imaging methods to understand techniques to visualise healthy and diseased…

A: Imagining methods are used for the visualization of internal structures of the body like organs,…

Q: table. What is the incidence rate of disease X among persons exposed to factor A? Exposure to Factor…

A: Answer: 0.04

Q: some examples in yourlife about microorganisms.

A: The term "Microorganisms" can be broken down into two words "micro" which means very small that can…

Q: T-cell receptor diversity is controlled by __________ a. DNA recombination during…

A: There are two types of diversity that occurs in T cell receptors combinatorial and junctional…

Q: h. 5: All of the following are true about cystic fibrosis EXCEPT: a) it affects a membrane calcium…

A: Introduction Cystic fibrosis refers to a chronic and serious genetic disorder or condition that…

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: Pyruria is defined as... Owhite blood cells in urine O blood in urine O strong smelling urine…

A: Urine is watery filtrate containing wastes such as ions and salts along with water produced by the…

Q: Explain the mechanisms for which the leaf water potential would be more negative at midday than at…

A: Water potential is defined as the potential energy of water in a system compared to pure water, when…

Q: Ch. 7: Hydronephrosis can be caused by: a) renal calculi Ob) tumors c) benign prostatic hyperplasia…

A: The ailments that lead to hydronephrosis most frequently in adults are as follows: Stones that can…

Q: Input . a) light b) odorant c)sweet molecule d) epinenphrine…

A: Senosry receptors are sensitive spots or specialised cells which convert stimuli from the…

Q: Plant hormones

A: Introduction: Plants need a lot of natural support for their existence and growth, including water,…

Q: 1. Read the excerpt below and answer the questions that follow. Native species of North America are…

A: The development of plants is defined by abiotic variables which establish their basic niche as the…

Q: What is the grade of raw milk in Figure 8? Grade of pasteurized milk?

A: Introduction The Resazurin test is designed for analyze the quality of bulked milk. this is based…

Q: DNA has the O thymine; uracil nucleotide, whereas RNA has the thymine; adenine O adenine; cytosine O…

A: INTRODUCTION DNA : Deoxyribonuleic acid RNA : Ribonucleic acid

Q: verall process that is called the Calvin-Benson cycle or the dark reactions of photosynthesis is own…

A: This is Calvin cycle which is the light independent reaction and the second reaction of…

Q: As humans age, the rate of cell division _____, which is intended to _______. Select one: a.…

Q: Which of the following is NOT part of the initiation of DNA replication in eukaryotes?

A: DNA replication is the process by which the duplication of genetic material occurs. DNA replication…

Q: Assume that the extracellular hydrophilic signal is acetylcholine. Describe the events that will…

A: G protein Coupled Receptor or GPCR are a class of membrane receptors that convert the extracellular…

Q: Ch. 5: Nocturnal asthma is caused by promote bronchoconstriction in the evening. a) decreased…

A: Bronchoconstriction in the evening is a common symptom of asthma. It typically occurs when the air…

Q: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids…

A: GC-MS can be used to separate and identify proteins, and HPLC is commonly used to separate lipids it…

Concept explainers

Risk Factors

The factors in the body that trigger the probability of suffering from a disease are referred to as risk factors. For example, an excessive increase in an individual's body weight can trigger the chances of getting heart disease. Similarly, if an individual is exposed to carcinogenic substances, it increases the probability of suffering from cancer. These factors can pose a severe threat to the overall health of an individual.

Question

Give detail explanation of what pathologies are involved in A woman has been trying for a baby without success.

Link the technologies:

Hormonal stimulation

Intrauterine insemination (IUI)

And (in vitro fertilisation)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Follow-up Questions

Read through expert solutions to related follow-up questions below.

Follow-up Question

What specific Pahtolgies can be linked to these technologies

Solution

by Bartleby Expert

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A woman has been trying for a baby without success for several years. Outline the tests that may be performed to assess her infertility and discuss the role of reproductive technologies in her treatment, with reference to specific pathologies which may be involved Provide examples. 500 words
When investigating fertility concerns, a common course of action is to rule out sperm cell-related causes of infertility first since obtaining the relevant specimens is generally less invasive. Sperm number and motility are typically the first parameters assessed in a semen sample. Vitality is another commonly assessed parameter, particularly when motility is deemed poor since it allows physicians to differentiate between live non-motile sperm and dead sperm cells. The procedure for determining vitality is to place sperm in a hypotonic solution and observe the specimen under the microscope after a 5-minute incubation. This short incubation time allows for observable cellular changes without causing cell death. What type of microscope would you recommend using to observe sperm cells for this laboratory test and why?
An average-weight woman without insurance coverage had unprotected sex and wants to avoid pregnancy. Describe the mechanism of action, pros, cons, and reliability of three different emergency contraception methods and make a recommendation for her specific situation.
When investigating fertility concerns, a common course of action is to rule out sperm cell-related causes of infertility first since obtaining the relevant specimens is generally less invasive. Sperm number and motility are typically the first parameters assessed in a semen sample. Vitality is another commonly assessed parameter, particularly when motility is deemed poor since it allows physicians to differentiate between live non-motile sperm and dead sperm cells. The procedure for determining vitality is to place sperm in a hypotonic solution and observe the specimen under the microscope after a 5-minute incubation. This short incubation time allows for observable cellular changes without causing cell death. What type of microscope would you recommend using to observe sperm cells for this laboratory test and why? Describe what you would expect to observe in the case of a live sperm cell and why? How can you distinguish it from a dead sperm cell in the same sample?
Conditions that cause the fallopian tubes to be narrower than normal may result in: Implantation of a fertilized ovum within the tube. More rapid propulsion of the ovum through the tube. Increased likelihood of pregnancy during each cycle. Excessive cramping and bleeding during menstruation .
A patient presents requesting hormonal contraception . She has been researching her options on the Web and has become confused by the large variety of OC pills available , including monophasic, multiphasic , and progesterone only . She asks how the pill prevents pregnancy and why the variety of preparations . Which of the following is the primary mechanism by which OCs prevent pregnancy ? Increasing cervical mucus viscosity Inhibiting serum follicle stimulating hormone (FSH) levels Inducing lymphocytic endometritis Inhibiting serum luteinizing hormone (LH ) levels
Describe the permanent sterilization procedures for both males and females. Be sure to mention the anatomy that is affected and the mechanism as to how this procedure will permanently prevent conception. AND THEN ALSO discuss at least two forms of reversible contraception. For each, identify how they function as well as any possible side effects, if any.
Make a learning objective for this topic: topic: Basics of teenage pregnancy Learning objective (should start with this line): 1. After ___ minutes of discussion, the client will 2. After ___ minutes of discussion, the client will 3. After ___ minutes of discussion, the client will
When investigating fertility concerns, a common course of action is to rule out sperm cell-related causes of infertility first since obtaining the relevant specimens is generally less invasive. Vitality is a commonly assessed parameter, particularly when motility is deemed poor since it allows physicians to differentiate between live non-motile sperm and dead sperm cells. The procedure for determining vitality is to place sperm in a hypotonic solution and observe the specimen under the microscope after a 5-minute incubation. This short incubation time allows for observable cellular changes without causing cell death. What type of microscope (light or electron) would you recommend using to observe sperm cells for this laboratory test and why?
Make a learning objective for this topic: topic: CONTRACEPTIVES FOR BIRTH CONTROL Learning objective (should start with this line): 1. After ___ minutes of discussion, the client will 2. After ___ minutes of discussion, the client will 3. After ___ minutes of discussion, the client will
Differentiate Family Planning from Contraception. Discuss the natural and artificial methods of contraception. Why do Women Die due to Pregnancy or Childbirth? Use the “Three Dalays Model”.
combination birth control pills contain estrogen and progestin. A typical pill packet contains 3 weeks of active hormones and 1 week of placebo pills. During the week of placebo pills, menstruation occurs. Use your knowledge of the hormonol control of the female reproductive system to: 1) Explain how the pills alter the feedback pathways of FSH and LH to prevent pregnancy. 2) Explain why menstruation occurs during the placebo week