Q: What specific type of transport pro dialysis tubing in this exercise?
A: Solutes are chemical molecules/compounds dissolved in a solution. Solvent is the medium in which…
Q: 1. Related of HIV (Tick the appropriate box) Risk group Medical Male Circumcision reduces the risk…
A: The two Lentivirus species that infect humans are the human immunodeficiency viruses (HIV).…
Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…
A: The environmental DNA methodology provides a number of benefits over conventional surveying…
Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…
A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…
Q: Which is not a characteristic of mitochondria? They .. A) Have 2 membranes B) Are the site of…
A: Cells produce energy molecules at the sites of mitochondria, which are membrane-bound organelles. It…
Q: Dichotomous Key Homework Use this Dichotomous Key and identify each of these seven leaves. You can…
A: Using the dichotomous key for the given leaves Following things can be concluded: (1):- It is a…
Q: PINK LAMP2A BCL2 ATF6 [Choose] [Choose] promoting UPR promoting apoptosis inhibiting autophagy…
A: PINK1 gene gives instruction to form PINK 1 protein. Highest level of this protein is found in…
Q: What would happen in the directionality of that activity were reversed? Would proofreading work? If…
A: Despite the remarkable accuracy of DNA replication, errors can occasionally happen, such as when a…
Q: Extranuclear inheritance can involve genes that are present in: ribosomes mitochondria…
A: Extra nuclear inheritance is also known as cytoplasmic inheritance. Extra nuclear inheritance is…
Q: Which molecule in the gel is the smallest - A, B, C, or D? Explain how you determined this. B)…
A:
Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…
A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…
Q: It is the proportion of replicate phylogenies that recovered a particular clade from the original…
A: A phylogenetic tree is a visual representation of the evolutionary connections between different…
Q: Which of the following is likely to be most important in the evolution of two species from one…
A: Whenever a subgroup within a species splits from other individuals of its species and acquires its…
Q: 2. According to the phylogenetic tree, which of your fishes are most closely related to each other?…
A: Seawater is denser than freshwater, marine fish have smaller swim bladders than freshwater fish. The…
Q: Explain why women who show no disease symptoms themselves can pass on inheritable immunodeficiencies…
A: Suppose a trait for disease is carried by a female on one of her X chromosomes and this trait is…
Q: Label the cell types found in the skin.
A:
Q: The mitochondrial membrane potential is an indicator of cell viability. Think about mitochondrial…
A: Mitochondria is the energy-generating organelle found in the cytoplasm of the eukaryotic cell. It…
Q: CALF RAISES Bones Muscles Joint type(s) Movement(s) Name an activity you could do in daily life that…
A: Calf muscle are present in legs.Calf raises excercise help to improvement in calf muscles. This is a…
Q: Label the images provided ---->(cell nucleus/nuclei, epithelium, connective tissue, muscle,…
A: Blood vessels are the tube through which the blood circulates in the body of the organism. It…
Q: List and explain how to detect adulteration of urine specimens.
A: Disclaimer: - According to BNED guidelines, only the first questions can be answered. Please repost…
Q: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
A: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
Q: Lets consider two genes A and B linked at 5 CM. The recessive mutant alleles "a" and "b" are…
A: Linked genes are genes that are located on the same chromosome and tend to be inherited together. An…
Q: Explain what is meant by the concept of "central dogma of molecular biology". Name the main…
A: An explanation of the movement of genetic information within a biological system is the core tenet…
Q: You are working with two different yeast cultures to study their genetics. But, you are not sure…
A: Saccharomyces cerevisiae, a yeast species, mates when two haploid cells of opposing mating types…
Q: The most common sexually transmitted infection in the USA is trichomoniasis caused by Trichomonas…
A: Diseases known as sexually transmitted diseases (STDs) are communicated from person to person…
Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…
A: When choosing an imaging modslity for detection of ischemic stroke, there are two choices, magnetic…
Q: ELODEA IN DISTILLED WATER Draw what the Elodea cells looked like when placed in distilled water.…
A: When Elodea leaf is placed inside distilled water, then the solute concentration of Elodea leaf will…
Q: What is diabetes type 1 and 2 and why does it occur ? and what is the tole of insulin pump for…
A: Insulin is a hormone, which is secreted by the pancreas which regulate the sugar in the body.
Q: 1. How Spallanzani’s experiment different from Needham?
A: John Needham hoped to eradicate all pre-existing microbes by briefly boiling broth flavoured with…
Q: Correctly label the following parts of the brainstem. Inferior cerebellar peduncle Midbrain Medulla…
A: The bottom part of the brain that connects the brain to the spinal cord is called the brainstem. It…
Q: Finally, you assess the whole skeleton for trauma and find 3 fractures and a gun shot wound. What…
A: The human skeletal system consists of 206 bones. Of these 80 bones belong to the axial skeleton…
Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)
A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.
Q: Myosin, a motor protein that interacts with actin to drive muscle movement, is bound to a phosphate…
A: Proteins are highly essential for the body to provide in maintaining structural and functional…
Q: Per alone Fill in with the mRNA strand, then translate to the amino acid sequence #1 DNA: AT…
A: For the vast majority part, creatures retain their genetic information as DNA. Each individual cell…
Q: Where does fertilization (the union of a sperm and egg) take place? vagina uterus ovary oviduct…
A: Introduction : Fertilization is the process by which the male gamete or the sperm fuses with the…
Q: Angiosperms are the outgroup on this phylogenetic tree. Group of answer choices a. True b. False
A: A phylogenetic, or hypothesized link between groups of creatures, is depicted in a diagram known as…
Q: The phase of the cell cycle in which cells perform thier cellular jobs is A) mitosis B) the G2 phase…
A: The sequence of activities that occur in a cell that leads to the replication of DNA and cell…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: do strawberry and raspberry fall under the category of eudicots
A: The eudicots, also known as eudicotyledons, are a group of flowering plants that are primarily…
Q: all of his sons all of his daughters half of his daughters and half of his sons half of his…
A: X- inactivation or lyonization is a process in which one of the X- chromosome is inactivated in…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…
Q: Public Health (MCQ) 1. If you are being a field doctor in the department of public health, are given…
A:
Q: Demonstrate how males are at an increased risk of sex-linked recessive traits by crossing a female…
A: Hunters syndrome is an X-linked recessive disease. The X-linked means the disease-causing gene is…
Q: Draw a diagram where cells are?
A: The fundamental units of all living things are cells. There are many billions of cells in the human…
Q: 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using…
A: While studying the global pandemic it is assumed that approximately 300,000 children or more might…
Q: eed Diabetes descriptions, introductions, and side effects and statistics and prevalance amongst…
A: Introduction: Polydipsia, polyphagia, and high blood glucose levels (hyperglycemia) are the main…
Q: If one nondisjunction event occurred during meiosis II, you would expect the four resulting gametes…
A:
Q: A) Determine the type of inheritance shown on this pedigree. Explain your answer. B) Based on your…
A: Ans - Considering Genotype detention as D - for not having disease allele and d- for having…
Q: In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the…
A: Genome of an organism can be defined as a sum total of all the genetic material present in it.Genome…
What is the purpose of the confirmed test in an experiment designed to test for coliform bacteria?
Step by step
Solved in 2 steps
- a) explain in your own words how to do a nitrate reduction test to identify unknown bacteria b) explain in your own words how to perform a phenol red broth (prb) test to help identify unknown bacteriaDescribe three problems associated with using the standard plate count method for determining the number of bacteria in a sample.What is the principle of Bial's test?
- how to find out the test is differential or selective in the microbiology lab test?What would happen if the enrichment method in the isolation of bacteriophage was omitted?the chloroform was not added to the enrichment?the 0.1 ml lysate - E.coli mix was plated directly on top of the bottom agar?What is the purpose of the TSI test?
- You perform the Methyl-Red (right) and Voges-Proskauer test (left). Interpret the results. Which methods would you use to determine is the bacterial sample is E. coli or P. vulargis? What results would help you to decide?Which chemotherapeutic agent was the most effective and least effective to each test organism (E. coli, P. aeruginosa, and S. aureus), respectively?You are testing a river water sample. Your "original" plate shows 100 coliform colonies. Assuming you did the serial dilution correctly, how many coliform colonies would you expect to see on your 1:10 plate? Your 1:100 plate? Explain.