What is the output if the following bash function is executed? #!/bin/bash function hello2() { echo yes; } hello2 Question 67 options: yes no hello2 hello
Q: Convert this code to bash script to simulate producer-consumer problem using semaphores. #include…
A: Actually, bash script for producer-consumer problem using semaphores has given below:
Q: Create a program that simulates a simple registration and login function. Your program should…
A: Q: Code the given problem
Q: Which of following function declaration makes a double parameter x to be passed-by-reference?…
A: Java is a programming language. It contains extensive libraries (package). It can be used to create…
Q: Part 1: Computer-Assisted Instruction (CAI) refers to the use of computers in education. Write a…
A: A function num_for_dif_1() is used to return single digit number for multiplication along with the…
Q: Suppose you have two columns, [Text1] and [Text2], in a MS Access table, how do you enforcethat only…
A: Validation rule to have value in one column:[Text1] and [Text2] are the two columns in a MS access…
Q: Write a bash script for an ABC organization fulfilling the following requirements Takes an…
A: #!/bin/bashread -p "Enter employee name: " enameread -p "Enter designation: " designationread -p…
Q: How can I fix that Traceback (most recent call last): File "C:\Users\Richard…
A: the answer is given below:-
Q: Book reference: Windows PowerShell Step by Step 3rd Edition - Ed Wilson Subj: PWS0 - PowerShell…
A: Chapter 7 Answer (4) The use of the args.count is to count the number of arguments passed in the…
Q: jobs
A: Process ID: 6458 Job no: 1 Status: Running If you look at the ps output, the first column depicts…
Q: 355. COW stands for? a. Copy over write b. Convert over write c. Count over write d. Copy over write
A: Given that, COW stands for? a. Copy over write b. Convert over write c. Count over write d. Copy…
Q: Please give flowchart for bash script read-p "Enter a number: " number read -p "Enter a minimum…
A: Flowchart for the given bash script is as given below hope you like it.
Q: Write a bash program that read in four integer numbers from the user and print out the sum and the…
A: We have to Write a bash program that read in four integer numbers from the user and print out the…
Q: Assume that the followings are the outputs of ps and jobs commands and answer the following…
A: Given:
Q: what is an alternative to backquotes (as in blah= wc -c hello.c) in bash. a. The dollar notation (as…
A: Below is the answer with reason :
Q: Write bash script which takes array as an input of size 10 bind its even indexes to accept even…
A: Actually, array is a collection of elements.
Q: .g. what they are, what they do) the following terms in your own words. 1. stdio.h (in C programs)…
A: The stdio.h is called header file of C language based library and stdio.h header defines three…
Q: Q Execute 1> Share main.kt STDIN sh Result fun main(args: Array) { 10 y:- 25 Skotline nowarn main.kt…
A: The Answer is
Q: 1) Explain, which is the operation of following code? which is the output of the code? INCLUDE…
A: The Answer is in step-2.
Q: te down the output and justify. Address: val = Oxabcd0c and p ocdf0. void func1(int val) { 1 3.…
A: You can read explanation below with each and every step .
Q: e a python script(.py file) that contains a function to import each file type .csv, .txt, .json, and…
A: Step 1: Below the python code that import file type .csv .txt .json . and xlsx Utilize the if…
Q: SI, OOH CX, 5 AH, 'A' INC SI CMP AH, DATA[SI] LOOPNZ LOOP HLT DB 00, 2F, 41, 20, a. It stops when it…
A: B. It stops when CX becomes equal to 0
Q: Write a bash script for a username management utility. This utility has predefined usernames stored…
A: Algorithm: Start Initialize uname array with some data Ask user to choose from the options…
Q: C Programming Language Task 1 - Create a file called data by running this command: head –c 10000…
A: Task 1: Head command: Here we first create a dummy character text file consisting of…
Q: 74. State true or false: Serializable level may allow both serializable and non-serializable…
A: a) True
Q: The following code should use Timer AO to trigger an ISR every 2ms. void main(void) { WDTCTL - NDTPW…
A: (a). What is the frequency of ISR Execution .(b) Based on the TAOCTL register configuration in the…
Q: Using the following data file (delimited by a space or tab) November 400 January 200 June 400 March…
A: Answer :
Q: Which all applies to Numpy? a. is homogeneous b. is memory efficient c. preferable for tabular…
A: numpy is a module available in python language and it stands for Numerical Python
Q: ___________ allows uncommitted data to be read a. Read uncommitted b. Serializable c. Repeatable…
A: Given mcq is related to dbms.
Q: What is the argument in the given codes below? def printMsg(msg): print(msg) printMsg("Hello") a.…
A: def printMsg(msg) This is a function definition where the name of function is printMsg and the…
Q: Which of the following is incorrect file handling mode in Python A. ab B. xr C. wb+…
A: A file is used to store data thus programming language like python, Java etc includes file…
Q: Consider the following ls -l output: -rwxr-xr-- 2 fred users 0 Jan 26 13:08 22…
A: 1) The output of ls -l shows perrmisson given to a file sample.mp3 2) -rwxr-xr-- 2 fred users…
Q: What will the following Python code print: i. a = "Jan&Fed&Mar&Apr&May&Jun"…
A: The Answer is in step-2.
Q: program fibo.sh to print out the first 15 numbers from the Fibonacci Sequen
A: the program is an given below :
Q: 3. MOV BX, 005Fh MOV AX, 0074h SUB BX, 000Fh CMC SBB BX, AX What is the value of BX after executing…
A: Given what is the value of BX after executing the following code answer is below step.
Q: Write a c program to copy content of one file to another file. You are need to take file path as…
A: The required C Program Code: #include <stdio.h>#include <stdlib.h>int main(){ FILE…
Q: Computer Science Write a C program that implements the producer and consumer problem
A: Hey there,I am writing the required solution for the above mentioned question below. Please do find…
Q: Select one: def f(x1, yl, x2, y2): s = x1 * x2 + y1 * y2 O a. return s def f(x1, y1, х2, у2):…
A: The expression definition is pretty clear that it will execute to some value. So, let's start by…
Q: Which of the following represent the output a. READ b. PROMPT c. STORE d. COMPUTE
A: Instructions are given in order to perform certain task like read, output, process etc.
Q: Typing ps alone lists the current running processes. lab3.c can be compiled as, gcc –o lab3 lab3.c.…
A: Note : As per policy i can answer one question at a time . Kindly resubmit the question separately .
Q: Load Enable A select Data Load Ro 1 →A Load 2 R1 3 Load R2 1 →B Load 2 R3 3 0 1 2 3 Decoder B select…
A: to enable data to be stored in r2 using and gate, load enabler must be disabled. enabling and…
Q: let S: r1(x);r2(x): w1(x);r1(x);w2(x);w1(y). Schedule S is said to be Select one: a. no serial and…
A: Here in this question we have given a schedule and we have asked that weather this schedule is…
Q: Allocate memory for a string of 15 characters and assign “new string” to it. Print the string. Now,…
A: GIVEN: Allocate memory for a string of 15 characters and assign “new string” to it. Print the…
Q: What does the following code display? var a = 1; function f() { function n() {…
A: var a = 1; // global vriable function f() { function n() { console.log(a); //…
Q: Find the contents of AX, BX and CX after execution of the following program: MOV AX, 6543h DEC AX…
A: The given program is:- MOV AX, 6543h DEC AX MOV CX, AX INC CX INC CX MOV BX, AX NOT BX ADD AX, BX…
Q: What is the size of Tray in the C snippet shown below? (Assume that 1 character occupies 1 byte)…
A: CODE(SCREENSHOT) : Explanation : in line 4 , a char array named x of size 5 is declared using…
Q: Assume that the followings are the outputs of ps and jobs commands and answer the following…
A: Given: Assume that the followings are the outputs of ps and jobs commands and answer the following…
Q: 10. Create a function based on the following information: Your mission is to encrypt a secret…
A: This C++ program takes the input of the string.
Q: Which is not a TRUE statement related to functions in C? Select one: a. Call by address passes…
A: In C programming, In call by value, the value of the actual parameters is copied into the formal…
What is the output if the following bash function is executed?
#!/bin/bash
function hello2() { echo yes; }
hello2
Question 67 options:
|
yes |
|
no |
|
hello2 |
|
hello |
Step by step
Solved in 3 steps with 1 images
- Program Requirements:You will develop a program capable of encrypt and decrypting text using Caesar cipher. In order to do this, you will be required to implement several functions, specified in the template provided.Once complete, your programs main() method should do the following:1. Prompt users to select a mode (encrypt or decrypt).2. Check if the mode the user entered is valid. If not, continue to prompt the user until a valid mode is selected.3. Prompt the user for the message they would like to encrypt or decrypt.4. Encrypt or decrypt the message as appropriate and print the output.5. Prompt the user whether they would like to encrypt or decrypt another message.6. Check if the user has entered a valid input (y/n) If not, continue to prompt the user until they enter a valid response. Depending upon the response you should either:a. End the program if the user selects no.b. Proceed directly to step 2 if the user says yes.You should use a loop to keep the programming running if the…Program Requirements:You will develop a program capable of encrypt and decrypting text using Caesar cipher. In order to do this, you will be required to implement several functions, specified in the template provided.Once complete, your programs main() method should do the following:1. Prompt users to select a mode (encrypt or decrypt).2. Check if the mode the user entered is valid. If not, continue to prompt the user until a valid mode is selected.3. Prompt the user for the message they would like to encrypt or decrypt.4. Encrypt or decrypt the message as appropriate and print the output.5. Prompt the user whether they would like to encrypt or decrypt another message.6. Check if the user has entered a valid input (y/n) If not, continue to prompt the user until they enter a valid response. Depending upon the response you should either:a. End the program if the user selects no.b. Proceed directly to step 2 if the user says yes.You should use a loop to keep the programming running if the…* Question Completion Status: exception Od. QUESTION 8 When the arguments in a function must be in the same order the parameters were written, we use arguments. O a. positional Default Values Ob. OC. Argument O d. Keyword QUESTION 9 Use the method to delete any whitespace exists at the left end of a string Click Save and Submit to save and submit. Click Save All Answers to save all answers. DELL F5 F6 F7 F8 F9 F10 F11 F12 PrtSc 50
- Program Requirements:You will develop a program capable of encrypt and decrypting text using Caesar cipher. In order to do this, you will be required to implement several functions, specified in the template provided.Once complete, your programs main() method should do the following:1. Prompt users to select a mode (encrypt or decrypt).2. Check if the mode the user entered is valid. If not, continue to prompt the user until a valid mode is selected.3. Prompt the user for the message they would like to encrypt or decrypt.4. Encrypt or decrypt the message as appropriate and print the output.5. Prompt the user whether they would like to encrypt or decrypt another message.6. Check if the user has entered a valid input (y/n) If not, continue to prompt the user until they enter a valid response. Depending upon the response you should either:a. End the program if the user selects no.b. Proceed directly to step 2 if the user says yes.You should use a loop to keep the programming running if the…C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…def test_func(a,b,c): return (a+b)/c This function is normally designed to be used with three numbers: a, b, and c. However, a careless coder may call this function with an ill combination of arguments to cause certain exceptions. Specifically, if any of a, b or c is not a valid number, then this code will produce a TypeError; and if a and b are valid numbers, and c is 0, then the code will produce a ZeroDivisionError. Your job is to enhance this function by adding proper try...except... blocks, surrounding and capturing the exceptions. When a TypeError occurs, instead of crashing, your code must print on the screen: "Code produced TypeError". And, when a ZeroDivisionError occurs, instead of crashing, your code must print on the screen: "Code produced ZeroDivisionError". In both cases, your function will not crash, will not throw an exception, and silently return None.
- with python do whis: Edit or delete a user profileWhen the user chooses 2, the first thing that it should do is to check whether the user information is loaded in the program (i.e., check if the user information is passed to the function that generates recipe recommendations). If the user information is passed to the function (i.e., the user chose option 1 before choosing option 2), the program should show the user the following menu:Hello (user name)You can perform one of the following operations:1) Delete your profile2) Edit your profilea. If the user chooses 1, perform the following subtasks to delete a user profile:1- Search for the user profile in the file userInformation.txt using the user name in read mode; once you find the user profile (i.e., the line that contains all the user information), pass it to a function that deletes the user information.2- The function should create a temporary file called temp.txt in write mode and search the file userInformation.txt in read mode…I need fix this code Please help me def add(a,b): return a+b def subtract(a,b): return a-b def multiply (a,b): return a*b def divide(a,b): try: return a/b except Exception as e: print(e) def power(a,b): return a**b def remainder(a,b): return a%b def select_op(choice): if choice == '#': return -1 elif choice == '$': return 0 elif choice in ('+', '-', '*', '/', '^', '%'): while True: num1s = input("Enter first number: ") print(num1s) if num1s.endswith('$'): return 0 if num1s.endswith('#'): return -1 try: num1 = float(num1s) except: print("Not a valid number, please enter again") while True: num2s = input("Enter second number: ") print(num2s) if num2s.endswith('$'): return 0 if num2s.endswith('#'): return -1 try:…c++ problem. PLEASE PASTE UR INDENTED CODE
- Unix assignment Purpose: The purpose of this assignment is to use various concepts of the C Shell. 0. Change your default login shell to the C Shell. 1. Create a .cshrc file in your home directory that will do the following: * Create the alias (lsall) that will do all of the following: display the date, and a recursive long list of all files in a directory. * Create the alias (whoson) that will display the date and a sorted list of users logged in. * Declare the LOCAL variable that controls the size of your history list to the value 200. * Declare the shell variable that will cause the C Shell to send a message to your terminal whenever one of your background commands complete. 2. Create a .login file in your home directory to do the following. * Declare the GLOBAL Terminal Type variable to the value vt100. Display the value of the variable. Logout and log back in to make sure your .cshrc and .login files are automatically executed. Create a lab8.scr…True or false: setInterval() executes a function repeatedly until the interval is cleared by clearInterval() using the ID returned by setInterval(). О а. True O b. FalsePython Code: Write a function that takes a single number as an argument: 1) This function should then check whether a number is an even number (2,4,6,8) and raise an exception if otherwise 2) Call this function with an uneven number first without catching the exception and then with catching the exception and printing a warning to the user afterwards Bonus: Do the same as the above but instead implement your solution for prime numbers and call the function with a non-prime number