Q: Distinguish between sensory and motor pathways in terms of direction and type of information…
A: In motor pathways the direction of information flowed from the cortex to the spinal cord and motor…
Q: Which of these conditions are always true of populations evolving due to natural selection?…
A: The mechanism by which communities of living things adapt and evolve is known as natural selection.…
Q: onsidering the 7 levels of gene regulation, which of the following mechanisms acts at first level?…
A: Gene expression is a tedious process involving several steps such as replication, transcription and…
Q: Describe what a pseudogene is and what impact they have on gene expression
A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.
Q: What is the most common portal of entry? Question 12 options: a) food & water b) mucous…
A: E. Respiratory aerosols
Q: explain the steps of what might happen inside a healthy mammary gland epithelial cell after it is…
A: UV light, or ultraviolet light, is a type of electromagnetic radiation with a wavelength that is…
Q: How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript?
A: A consensus coding sequence (CDS) is a method used in next-generation sequencing (NGS) to identify…
Q: Which substance is a molecule rather than an element? O hydrogen carbon dioxide O phosphorous O…
A: Elements and molecules are the different forms of chemicals present in the surroundings as well as…
Q: Can you Describe in 1500 words, Planning Cycle for a Health Program?
A: Health program basically means to provide basic preventive ideas to prevent the spread of…
Q: Which of the following are reproductive organs? Select all that apply A. Root B. Leaf C. Stem…
A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…
Q: Transcription start site selection by S. cerevisiae Pol II occurs over a range of positions located…
A: Introduction: Transcription start sites (TSSs) are acquired by RNA polymerase II (Pol II) in…
Q: PROTEIN VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Amino Acid Carboxyl Group…
A: Proteins are usually called as building block of the life. Many proteins play important roles in…
Q: Evaluate the suitability of DNA and RNA as genetic material and justify the suitability of the one…
A: The evaluation of suitability of DNA and RNA as genetic material can be established on the…
Q: 11. What is the result of light energy absorbed by photosystem I? a. b. C. d. It energizes an…
A: In a non-cyclic photophosphorylation Photosystem I (PS700) absorbs light energy. It results in the…
Q: What are some examples of diffusion, osmosis, facilitated diffusion and active transport?
A: The body employs a range of mechanisms to maintain balance, each with its own specific functions and…
Q: What are the differences between acute and chronic amoebiasis?
A: Humans gastro-intestinal system infections like amoebiasis are rather prevalent. Environment is less…
Q: 7. If an organism that is homozygous recessive for a trait is crossed with a heterozygote, what is…
A: Understanding patterns of characteristics transmission requires knowledge of the fundamental…
Q: Nucleic Acids are polymers made of building blocks called There are two types of nucleic acids. is…
A: Nucleic acids are complex biomolecules. They are of two types RNA and DNA. Among these, DNA acts as…
Q: Write the 3 short term effects and 3 long term effects in given classification of substance
A: Drugs are the substances which have physical or physiological effects on the body.Drugs are used to…
Q: Sensorineural hearing impairment
A: a. Sensorineural hearing impairment: sharp increase in thresholds for higher frequencies no air-bone…
Q: C. Compare the trophozoites of the following parasitic and commensal amoeba. Structure Maximum…
A: Trophozoites it is a stage of critical development for the parasites which is morphological changes.…
Q: Define the endosymbiotic theory. Explain how mitochondria and chloroplasts evolved by endosymbiosis.…
A: Life in the world started as a single celled organism. By means of accumulation of mutations,…
Q: options: Water volume positively affected the growth of tomato plants in section 1 of the garden…
A: Fertilizer B worked the best. The tomato plants in this section of the garden grew the least after…
Q: 1. Give various definition for morphology? 2. What is your own definition of morphology?
A: Greek morph-, which means "shape, form," and -ology, which means "the study of something," combine…
Q: ompares the processes of diffusion, facilitated transport, osmosis, and active transport.
A: Diffusion, facilitated transport, osmosis, and active transport are the ways by which a cell takes…
Q: What is the difference between quantitative and qualitative analysis? Give several examples. Define…
A: Quantitative analysis : Quantitative analysis is expressed in numbers and graphs. It is used to test…
Q: what might happen to a cell that was damaged by UV light and that has E2 inside the cell
A: UV ray is a radiation that is a form of non ionizing radiation . Which emitted by the sun. It use to…
Q: The genetic diversity of the moss Polytrichum commune was analysed in two peat bog ecosystems.…
A: A species' genetic diversity refers to the variation in its genes and genotypes. It is critical for…
Q: What is herd immunity? How does it protect us against illnesses?
A: Herd immunity is a concept that describes the resistance to the spread of a disease within a…
Q: Definition of morphology should capture every bit of important information.
A: Since morphological traits specific to a certain species are used to identify it, morphology is…
Q: Which type of mechanism best repairs thymidine dimers caused by exposure to UV light? a. Nucleotide…
A: INTRODUCTION Thymidine Dimers: Cyclobutane thymine dimer, a photo lesson caused by sunlight's UV…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: 2. On a sunny day, you enter a dimly lit room and see an apple. At first, the apple looks like the…
A: ANSWER) The illumination of the objects is determined by the diameter of the pupil, larger the…
Q: 4.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…
A: Beluga whales are a unique and fascinating species that are found in Arctic and sub-Arctic waters.…
Q: A patch-clamp device is used to a. Study the properties of individual neurotransmitters b. Study the…
A: A flexible electrophysiological method for analysing ion channel function is the patch-clamp method.…
Q: List examples of the synthetic, metabolic, and excretory functions of the kidney
A: Understanding the functioning of the body's systems is essential for several reasons. By…
Q: Do free-living amoebae cause illness in man? If so, enumerate some of these opportunistic amoeba and…
A: Introduction: Acanthamoeba spp., Balamuthia mandrillaris, Naegleria fowleri, and sappinia are…
Q: Macromolecule Carbohydrates Lipids Proteins Nucleic Acids Monomer Amino Acids Elements Present C,H,O…
A: Large, naturally occurring cellular components known as biological macromolecules perform a number…
Q: BELL JAR EXPERIMENT In the early 1770s, Joseph Priestley conducted a series of experiments that…
A: Introduction Plants produces their own food (carbohydrate) in the presence of sunlight, carbon…
Q: s false regarding the role of mediator complex in eukaryotic transcription
A: a. Mediator complex interacts with RNA pol II
Q: Which of the following is true about MHC? Check all that apply. A. MHC I is expressed in all…
A: Major Histocompatibility Complex(MHC) is basically a group of genes on DNA.It mainly helps the…
Q: 5. Which of the following is considered acellular? Aspergillus fumigatus Mycobacterium tuberculosis…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: of 1. One method of DNA sequencing involves the use chemiluminescent enzymes (e.g., luciferase) to…
A: DNA sequencing: It is a method of knowing the nucleotide sequence of a DNA molecule. Various…
Q: Compare and contrast diabetes mellitus and diabetes insipidus.
A: Diabetes is a chronic disease that lasts for a long period of time and is typically characterized by…
Q: Make clear your understanding of polyneuropathies by providing the type of structure affected (its…
A: Nerves allow us to feel and respond to our environment. Nerves control the muscles, allowing us to…
Q: 3. Hydrogen bonds are quite weak compared to covalent bonds. Explain why this fact is actually…
A: ANSWER: Hydrogen bonds, despite being weaker than covalent connections, are sufficient to keep the…
Q: What conclusions can be drawn from the table ?
A: Introduction- The Cardiac CycleRefers to the events of 1 complete heart beat- Both atria &…
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: During which month is CO2 level the highest ? the lowest? This question has two parts and requires…
A: The most significant greenhouse gas on Earth is carbon dioxide, which both absorbs as well as…
Q: functions of, and describe Cerebrum, Cerebellum, Corpus callosum, Pons and Medulla oblongata.
A: Introduction: The brain is a sophisticated organ that manages every bodily function as well as…
What are the factors affecting the pathogenicity of a
Step by step
Solved in 2 steps
- Why can it be said that N. equitans is both a carbon and anenergy parasite?Mycorrhizal fungi form obligate symbiotic relationships within plants. They are able to fix N2 into a usable form of nitrogen. In exchange, they receive nutrition from the plant. Which of the following is a true statement concerning mycorrhizal fungi? a) Finding a host plant is not crucial to their survival. b) They are a dominant species. c) They cannot survive without the host plant. d) They are considered plant parasites.Symbiosis is a close relationship between different species where at least one requires the other for survival. Parasitism, commensalism, and mutualism are the major types of symbiosis. Why is the relationship between Rhizobium and its host considered mutualism and not one of the other types of symbiosis?
- Why do yeasts generally have to be cultured for longer periods than most bacteria? Can bacteriological media be used for the cultivation of molds? Explain your answer. What is the difference between vegetative and aerial mycelia? What are the three classes of antifungal drugs based on their mechanism/site of action? Describe the mode of action of each class. Name one fungal virulence factors that promote fungal colonization. Explain the mechanism. Name one fungal virulence factors that damage the host. Explain the mechanism.What two microbes form a partnership in the lichen symbiosis?What are the benefits to both partners?A mature amoebae cyst that has four ring-like nuclei could be a) Entamoeba histolytica b) Entamoeba coli c) Entamoeba dispar d) Entamoeba gingivalis
- Describe the life cycle of Paragonimus westermani and its method of transmission to humans with crayfish and snail as the intermediate hosts. Show in a diagram and an explanation.In terms of geographical distribution, are parasitic flagellates (e.g., Trypanosoma spp., Leishmania tropica, Giardia lamblia, Trichomonas) cosmopolitan or localized? Explain Discuss the relationship between vector distribution of some parasites and their vectors, if any? Do they exhibit vector specificity?Which part of tobacco plant is infected by meloidigyne incognita?