Use the following information to answer the next question. Small Segment of DNA Uracil Adenine 2 Thymine 6 Deoxyribose 5 4 The molecules uracil, adenine, thymine, and deoxyribose, respectively, are labelled with which numbers? Select the number from the dropdown menus beside the molecules. Complementary Segment of RNA ▶ 6 DA 5
Q: Which statement is true of viral replication? A) virus attaches to a specific receptor site on…
A: A virus is a non-cellular, infectious entity that is minuscule in size and can survive by surviving…
Q: In Deuterostomes, nutrient molecules (monomers) are taken in to the space between the endoderm and…
A: Option (a) is incorrect because, in Deuterostomes, nutrient molecules (monomers) are taken up into…
Q: what is the frequency of the rarest variant you can detect during deep sequencing of a tumor cell if…
A: A tumour cell is a type of abnormal cell that is produced and reproduces at an abnormally rapid…
Q: Chloroplast genomes have sequence homology to cyanobacteria genomes. (True or false)
A: Sequence homology is a concept used in molecular biology and biochemistry to describe the degree of…
Q: Why is the progeny always tall when a tall pea plant is crossed with a short pea plant?
A: The offspring of two parents can be distinct from both parents due to the formation of unique…
Q: Next you take measurements of different long bones to estimate stature. Humerus length = 30.04 cm…
A: Given that: Humerus length = 30.04 cm Femur length = 42.5 cm Tibia length 33.88 cm = Using humerus…
Q: what technique was used to figure out if some Tasmanian devils would be more likely to survive the…
A: A condition known as cancer occurs when some body cells grow out of control. Since the human body…
Q: if you were to measure the PH of chyme in the duodenum and found it to be between 7 and 8, would…
A: When the food that has been consumed reaches the stomach it undergoes digestion by muscular…
Q: Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct…
A: Process of synthesis of RNA from DNA is known as transcription. As the colum A in the table…
Q: Describe 4 ways that your skin protects you from infectious diseases.
A: 1. The skin or epidermis of our body is an intact outer layer of our body. This is not permeable to…
Q: What is an example of a measurement error statment for doing an experiment dealing with counting…
A: Colony-forming unit (CFU, cfu, or CFU) is a unit used in microbiology to measure the number of…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: Please match the appropriate attributes for the two hormones provided (Estrogen and ADH) Hormone…
A:
Q: 2. What biochemical markers can indicate liver problems? What tests should then be used to identify…
A: Laboratory liver tests help diagnose and treat patients with liver dysfunction. The metabolism of…
Q: Use the following information to answer the next question. Life Cycle of a Butterfly Adult…
A: Nondisjunction in meiosis II comes from the failure of the sister chromatids to split during…
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…
Q: Explain how is the rasberry is related to strawberry, banana and grape?
A: Pollen is a plant's male reproductive cell. It results in the development of edible fruits and seeds…
Q: What bacteria is growing on this nutrient agar?
A: Microorganisms require nutrients for life, development, and reproduction, which are provided by…
Q: 1) What is typological thinking? Does this way of thinking support the idea of evolution?
A:
Q: POSITIVE. GRAM- NEGATIVE. 2. Rods..... Cocci...... 3. Gelatin test positive.... Gelatin test ...Go…
A: Enterobacter cloacae is a clinically relevant Gram-negative, facultatively-anaerobic, rod-shaped…
Q: Myosin, a motor protein that interacts with actin to drive muscle movement, is bound to a phosphate…
A: Proteins are highly essential for the body to provide in maintaining structural and functional…
Q: Finally, you assess the whole skeleton for trauma and find 3 fractures and a gun shot wound. What…
A: The human skeletal system consists of 206 bones. Of these 80 bones belong to the axial skeleton…
Q: A. DETERMINING Table 11-1. Osmosis experiment data: mass of bags (g) Time 0 min 15 min 30 min 45 min…
A: Bag no. 2, Bag no. 3 and Bag no. 4 are gaining mass. Water and sucrose molecules both are directly…
Q: Which of the following could not be used a a host cell receptor for viral entry? a.) LPS on…
A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…
Q: Which of the following exhibits embryonic development by the protostome pathway?
A: Embryo development is the term used to describe the many stages of embryo development. Animals and…
Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…
A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…
Q: Next, it's important to understand how the gene would be transcribed and translated. 1 agagtctcct…
A: i. Coding region of this gene is 288 nucleotide long. ii. We all know that exons are the coding…
Q: Is Enzyme a monomer or polymer?
A: Question : Is Enzyme a monomer or polymer ? Answer : Enzyme is a polymer of amino acids.…
Q: The simple act of covering the nose and mouth with a tissue when coughing or sneezing is an…
A: Introduction: Our reflexive ability to cough serves to shield our lungs and airways from irritants.…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: Every month, either ovary releases an egg. 1.The uterus's walls swell to become thick and pliable,…
Q: A mysterious young man who calls himself Matthew has appeared upon the doorstep of Yel. Matt claims…
A: PCR or the Polymerase Chain Reaction is a molecular technique that is used to amplify desired DNA…
Q: Signs and symptoms of Asthma in detailed
A: Introduction Your airways may swell, become more constricted, and create more mucus if you have…
Q: How do virus infection and chemicals may cause cancer? Give examples and mechanisms.
A: A virus can only replicate and create new viruses by entering a live cell and taking control of the…
Q: 1) Compare and contrast population ecology, community ecology, and ecosystem ecology
A: Ecology derives from the Greek terms for "HOUSE" and "DISCUSSION/SPEECH," OIKOS LOGOS. The planet is…
Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…
A:
Q: 1. Explain what primers are and what purpose they serve in a PCR reaction. Explain the main steps…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: which of the following sequencing techniques needs the highest coverage? o deep sequencing o de…
A: Deep sequencing is the process of repeatedly sequencing a genetic region—often hundreds or even…
Q: 1. How Spallanzani’s experiment different from Needham?
A: John Needham hoped to eradicate all pre-existing microbes by briefly boiling broth flavoured with…
Q: Wild type 0.09 E104K G238S --+-- 0.13 1.41 A42G G238S ‒‒‒ E104K A42G -++-- 1.41 --+-+ 362 G238S A42G…
A: Antibiotic dosing regimes could be tailored to enhance the efficacy of the drugs by being able to…
Q: What is the general function of the structure labeled A? Convert the incoming sound from pounds…
A: Ear is the sensory organ which help in hearing and balance maintanence Ear is divided into three…
Q: Below is an image of the results of a gel electrophoresis experiment. Lanes 1-4 contain amplified…
A: In gel elctrophoresis, smallest DNA fragment travels the farthest. (A) From the diagram, we can see…
Q: Describe the process of RNA interference (RNAI). Include the proteins involved, how the process…
A: RNA interference is an evolutionarily conserved process activated by double-stranded RNA that turns…
Q: Discuss how histologists can use visualization of epithelial tissue to help with diagnosis of…
A: Note: Sorry, as per the honor code we are not allowed to cite external sources. Thank you!…
Q: describe the IR spectra pattern of ascorbic acid (Vitamin C)
A: Analysing Infra Red (IR) spectra of any compound provide an idea about their identification through…
Q: transport substances through the blood
A: Question : Which is not a function of a protein. Answer: Transport substances through the blood.…
Q: "To discard the household waste we should have two separate dust-bins, one for the biodegradable…
A: The term waste refers to unwanted or unusable materials that are left behind. They are classified…
Q: 4.08 ¡Î1.02↑ E E 2.54 H H 1.02 Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H =…
A: An RNA transcript or the DNA encoding its introns are non-coding segments that are spliced off…
Q: IPTG (isopropylthiogalactoside) is commonly used to induce protein expression in Lac…
A: IPTG, also known as isopropyl d-1-thiogalactopyranoside, is a molecular biology tool. This substance…
Q: A deficiency in cholesterol will have the largest effect on the activity of what organ
A: Introduction:- Cholestrol is a type of sterol. Sterols are the class of steroids that have a…
Q: #1 3. Explain how this relationship between the solution and the Elodea cells (from #1) caused what…
A: When compared to the intracellular solute concentration, an isotonic fluid has the same solute…
Step by step
Solved in 2 steps
- A toxin is glycopeptide, X that is composed of an octapeptide and a saccharide Y. Glycopeptide X is composed of a glycan Y and an octapeptide. The octapeptide was cleaved by trypsin, giving 2 tetrapeptides of exactly the same composition except for its N-terminals. When the octapeptide was cleaved by chymotrypsin, it gave a pentapeptide and a tripeptide. DNFB treatment gave DNP-ser. The composition of the octapeptide is lys, ser, trp.and leu. The leu:ser ratio is 4:1. 1. What is the sequence of this octapeptide? Saccharide Y is a tetrasaccharide. To determine its linkages, a person methylated glycopeptide X effectively methylating saccharide Y. Cleavage gave the peptide and the following products: 2,3,4-tri-O-methyl-a-D-glucopyranoside acid, 2,3-di-O-methyl-ß-D- glucopyranoside, 1,3,4-tri-O- methyl-ß-D-glucuronic acid treatments to the isolated tetrasaccharide gave the following results: and 1,4,6-tri-O-methyl-ß-D-N- acetylgalactosamine. Further 1. A. Treatment of saccharide Y with an…Define the following terms:a. thiamine pyrophosphateb. lipoic acidc. PHDCd. HETPPe. nucleoside diphosphate kinaseWhat will be the effect of the following changes to the protein structure of hemoglobin and its function? A. Replacement of the proximal histidine residue at the 8thposition of the F helix by asparagine. B. A phenylalanine to proline mutation resulting in decreased cooperativity of the polypeptide chains. C. Replacement of a nonpolar amino acid in the interior of the protein to a hydrophilic amino acid.
- Define the following terms: a. intrinsically disordered protein b. intrinsically disordered region c. prosthetic group d. apoprotein e. molecular chaperoneShow the peptides that would result from cleavage by the indicated reagent: a. Val-Arg-Gly-Met-Arg-Ala-Ser by carboxypeptidase A b. Ser-Phe-Lys-Met-Pro-Ser-Ala-Asp by cyanogen bromide c. Arg-Ser-Pro-Lys-Lys-Ser-Glu-Gly by trypsinA solution of peptide of unknown sequence was divided into 2 samples. One sample was treated with trypsin and the other one with pepsin. The fragments produced are given below: TRYPSIN A. Pro-Gly-Met-Phe-Leu-Arg B. Gln-Ile-Pro-Lys C. Ala-Gly-Trp-Lys PEPSIN A. Phe-Leu-Arg-Ala-Gly В. Pro-Gly-Met С. Тrр-Lys-Gln-Пе-Pro-Lys Deduce the original polypeptide chain.
- A heptapeptide was analyzed by Pinky. She reacted it with carboxypeptidase and found out that it reacted with proline. Partial hydrolysis of the heptapeptide gave the following shorter peptides: Tyr-Leu Ser-Arg Tyr-Trp-Ser Tyr-Leu-Pro What is the sequence of the heptapeptide? Input the three-letter codes of the amino acids separated by dashes with no space character (e.g. Arg-Ser-Leu).Define the following terms:a. Rieske proteinb. Psa dimerc. D1/D2 dimerd. A0e. A1Match the following nucleobases (designated AD) with their names and answer questions about them. NH, NH, C D NH2 Note that some of the items from the answer list should NOT be used. Guanine 1. Aand B - Cytosine 2 Cand D • Adenine 3. Not shuwn v Thymine 4. D v Uracil 5. B a Aand C v Which of tho shown bases are pyrimidines? 7. A and O v Which of the shown bases form canonical A-T Watson-Crick base pair? S. A v Which of the shown bases form canonical G-C Watson.Crick base-pair? 9. Band C 10. C 11. Band D
- A peptide with endorphin-like property was produced and obtained from the blood. This was sequence using the protocol: Treatment with streptococcal protease gave a tripeptide and a tetrapeptide. Treatment with trypsin gave two tripeptides and an amino acid. Treatment of the 2 tripeptide products in 1.2 with 2,4-dinitrophenol gave DNP- S, and DNP-E and a mixture of amino acids. The composition of the peptide is G, E, S, and K in a 2:1:1:3 molar ratio. a. Determine the sequence of the peptide? b. Determine the pl and position in an electrophoretic profileA peptide with endorphin-like property was produced and obtained from the blood. This was sequence using the protocol: Treatment with streptococcal protease gave a tripeptide and a tetrapeptide. Treatment with trypsin gave two tripeptides and an amino acid. Treatment of the 2 tripeptide products in 1.2 with 2,4-dinitrophenol gave DNP- S, and DNP-E and a mixture of amino acids. The composition of the peptide is G, E, S, and K in a 2:1:1:3 molar ratio. What is the sequence of the peptide?Draw the peptide formed between asparagine and histidine. H,N- -CH-C-OH H,N-CH-ċ-OH ČH2 ČH, N° NH2 -NH +