Transfer RNA Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. is larger in size if the protein to be made is longer in amino acid sequence. b transfers amino acids from proteins to mRNA. C is a type of ribosome a e matches amino acids with the correct codon in the mRNA. is a nucleic acid that alone codes for the primary structure of protein.

Transfer RNA Selected answer will be automatically saved. For keyboard navigation, press up/down arrow keys to select an answer. is larger in size if the protein to be made is longer in amino acid sequence. b transfers amino acids from proteins to mRNA. C is a type of ribosome a e matches amino acids with the correct codon in the mRNA. is a nucleic acid that alone codes for the primary structure of protein.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 4TYU: The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA...

See similar textbooks

Similar questions

Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They contain exons and introns _____ 2. They are the template of genetic informtaion during protein synthesis ______ 3. They contain unusual or modified nitrogenous bases ______ 4. They display an anticodon each ______ 5. They have a cloverleaf structure ______ 6. They are synthesized by RNA polymerases ______ 7. They get charged with an amino acid by aminoacyl-tRNA synthetase ______ 8. They are capped on their 5' ends and polyadenylated on their 3' ends 9. There are 4 types of these in eukaryotes and only 3 types in E. coli ______
Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is false
A small section of mRNA codons has the following sequence:UGG GAA ACC UUC Some Amino Acids Aspartate Glutamate Glutamine Isoleucine Threonine Methionine Asparagine Tryptophan Phenylalanine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as if you were a ribosome, and write out the translation results. A genetic code table has been provided. mRNA: 5'- A C G U C C A A U G G C A G U G A U U U G A A U C C A -3'
Anticodons are located on __ Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a MRNA b TRNA FRNA d none of the above
Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They are capped on their 5’ ends and polyadenylated on their 3’ ends 2. They contain unusual or modified nitrogenous bases 3. There are 4 types of these in eukaryotes and only 3 types in E. coli 4. They contain introns
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the first AUG (start codon) in the sequence, starting from the mRNA 5’ end. When writing the amino acids that are found in the protein, you may use the single-letter code, three-letter code, or full amino acid names.
Complete what is being asked and finally with the Genetic Code table, determine what specific amino acids will be finally formed. Given DNA strand 3’ T A C T A G C C T A C T G C G 5’ 1. The partner strand of the given _________________________________ 2. The mRNA strand formed _____________________________________ 3. The tRNA _________________________________________________ 4. The amino acids formed are __________________________________
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. mRNA in eukaryotes, can exist outside the nucleus acts as an enzyme for peptide synthesis composed of ribonucleic acid rRNA Answer Bank moves amino acids to the site of protein synthesis tRNA contains nucleotide triplets that code for specific amino acids has a convoluted structure with a three-base sequence called an anticodon moves genetic information out of the nucleus and into the cytoplasm mRNA, rRNA, and tRNA
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'