Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA: 3¹- DNA: 5'-AGCAGTTACCA-3'
Q: Deduce the amino acid sequence of a polypeptide from the following: 1. Acid hydrolysis gives Ala2,…
A: Deducing the amino acid sequence of a polypeptide from the analysis of peptide fragments generated…
Q: Arrange the balanced biochemical equations for all the reactions in the catabolism of glucose to two…
A: The glycolysis preparatory phase involves the conversion of glucose to two molecules of…
Q: The membrane potential in animal cells depends largely on resting K+ channels. How do these channels…
A: ATP synthase is a large and complex enzyme that converts ADP and inorganic phosphate into ATP. The…
Q: In bacterial teansfomation, why is 42oC being used as the chosen temperature for heat shock…
A: In bacterial transformation, heat shock is used to increase the efficiency of the transformation…
Q: Tyrosine kinase receptors are pairs of proteins that span the plasma membrane. On the extracellular…
A: Ligand receptor system - consist of cell-surface receptors (membrane-anchored proteins) outside…
Q: Identify the main groups and one use of each of these compounds Functional Groups Phosphoglyceride…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: The Neanderthal nuclear genome: A. Shows that Neanderthals inherited their ability to flake stone…
A: Homo neanderthalensis, or Neanderthal man, is an extinct human species that inhabited Europe and…
Q: HO H. OH 2-H OH OH 20. To the left is the structure of ribose, with (most of) the carbons numbered.…
A: Ribose is a five-carbon monosaccharide that is a component of nucleotides, the building blocks of…
Q: 148. A 42-year-old man has persistent swelling and tenderness of his right great toe joint. Turbid…
A: Gout is a type of arthritis that is caused by the buildup of uric acid crystals in the joints. Uric…
Q: 4 Dichlorophenol (the substrate) is degraded by an enzyme with the following data collected for…
A: Rate of enzyme reaction is measured by the rate at which substrate is used up or product is formed.…
Q: Write the structure of the following peptides Expanded structure. Use any other ink for peptide…
A: The proteins are composed of twenty naturally occurring amino acids. The proteins are assembled by…
Q: The figure below shows an absorption spectrum of DNA obtained using NanoDrop. Is this DNA…
A: DNA and RNA are the nucleic acids that are made up of nucleotides. The concentration of these…
Q: 1. Draw the structure of a cholesterol ester where cholesterol is esterified with palmitic acid. is…
A: The four classes of biological macromolecules are nucleic acids, proteins, lipids and carbohydrates.…
Q: A higher concentration of NADH in the liver is associated with an increase in gluconeogenesis. Your…
A: NADH (nicotinamide adenine dinucleotide) is a coenzyme that plays a critical role in many cellular…
Q: identify ways in which you could increase the accuracy of the experiment so you could determine with…
A: Performing an experiment requires following ethical and practical guidilines. In a good lab…
Q: Human insulin is prodụced as a recombinant protein in the yeast Saccharomyces cerevisiae The protein…
A: A glycosylated protein is a protein that has a carbohydrate moiety attached to it. Given to us are…
Q: In which phase of aerobic respiration is the main part of ATP formed? Electron transport chain…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: You will be given 1 mL of a 2.0 mg/mL solution of bovine serum albumin (BSA) and 1 mL of a 2.0 mg/mL…
A: Dilution in biochemistry is used to lowered and get the desired concentration of solute solution by…
Q: A diet deficient in folic acid is highly unlikely since folic acid is found in almost all foods.…
A: A diet deficient in folic acid can have serious health consequences. Folic acid, also known as…
Q: Order the following TCA cycle metabolites in the order they are produced in one turn of the citric…
A: The TCA cycle operates in the matrix of the Mitochondria. It is the final common pathway for the…
Q: In chymotrypsin, a mutant was constructed with Ser 189, which is at the bottom of the…
A: Chymotrypsin is a digestive enzyme that is produced in the pancreas and plays an important role in…
Q: Draw the resonance structure of a tripeptide peptide backbone, indicating the N- and C-terminal and…
A: Peptides are molecules composed of amino acids joined together through peptide bonds. The peptide…
Q: 1.a)High fructose corn syrup (HFCS) normally has approximately what composition? ('> means more…
A: Fructose is a simple sugar, also known as fruit sugar, that is found naturally in many fruits,…
Q: Question 37 The following peptides were measured for a longer sequence that you are interested in…
A: The proteins are composed of twenty naturally occurring amino acids. According to Anfinsen's…
Q: (a) Fill in the blank regarding the mechanism of chymotrypsin below. (1) Polypeptide substrate binds…
A: Serine proteases are protein cleaving enzymes that have Serine, Histidine and Aspartate (the…
Q: NADPH inhibits glucose-6-phosphate dehydrogenase. What kind of inhibitor is NADPH?
A: Glucose-6-phosphate dehydrogenase (G6PD) is found in the cells of many organisms. It plays an…
Q: If you crate the absorbance spectra of a solution containing dna protein and buffer using buffer as…
A: The absorbance spectrum is formed by plotting the Absorption values against the wavelength at which…
Q: Various concentrations of recombinant human insulin were prepared for use standards for an HPLC…
A: Beer's Law states that the absorbance is proportional to concentration of the given solute which is…
Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: .Hanes-Woolf 2.Michaelis Menten 3.Lineweaver-Burk limitations: A. This plot appears to allow for…
A: For enzymes that follow Michaelis Menten-type kinetics, the determination of accurate values of Km…
Q: H3K4me3 means Histone 3, Lysine residue #4 methylated with three methyl groups O True O False
A: Histone modification is the covalent modification of histone proteins, which are responsible for DNA…
Q: Using the cultured cells used in this experiment and described in the introduction, how would you…
A: When increasing amounts of the labelled ligand are added to the cells, the amount of binding will…
Q: If a solution of DNA is 3 mg/ml, 0.5 mg of DNA would be contained in how many ml?
A: The following steps will explain the calculation of volume of solution required for 0.5 mg of DNA…
Q: Discuss the similarities and differences between DNA and RNA. Be specific and use your own words.…
A: DNA stands for deoxy ribonucleic acid where as RNA is ribonucleic acid. Nucleic acids are the…
Q: What is Monoamine neurotransmitter, Amino-acid neurotransmitter, and neuropeptides?
A: Amino acids are a type of biomolecule that is involved in several biological and chemical functions…
Q: Depending on the type of microbe, the pyruvate generated in glycolysis can be used for fermentation…
A: Glycolysis is the process of breakdown one molecule of glucose into two molecules of pyruvate and…
Q: 3. If PCR were performed on a highly conserved gene from two species, one prokaryotic and one…
A: A conserved gene is a gene that has remained largely unchanged over a long period of evolutionary…
Q: Which organisms below take part in the carbon and sulfur cycle? Explain their function in the…
A: Nutrient cycles ensure the supply of various nutrients and elements in the environment. Microbes and…
Q: Which of the following amino acids is non polar at ph 7
A: Amino acids are usually polar molecules and their polarity is the result of amino group (-NH2) and…
Q: What makes RNA a ribozyme? Why are DNA enzymes absent?
A: Enzymes are biomolecules which can catalyze the biochemical reactions. These can be proteins, RNA or…
Q: 1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble.…
A: B vitamins are water soluble vitamins which are of classified into 8 types. they are Thymine ,…
Q: first pass metabolism
A: The mechanism of first-pass metabolism involves the biotransformation of a drug or substance by…
Q: 5. The amino acid sequences of three peptide fragments are shown below. Peptide 1: QAMGRAGDLKYLGLHSV…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Create a concept map connecting diabetes and gluconeogenesis inhibitors
A: Gluconeogenesis is the metabolic pathway that generates glucose from non-carbohydrate precursors.…
Q: Sweetzyme IT Extra is a trademarked immobilized enzyme formulation of glucose isomerase sold by the…
A: Vmax = k2[E0] =0.570 s-1 × 2.30×10-5 M = 1.311×10-5 M s-1
Q: 3.) As mentioned in the March1 outline a critical step in the glycolysis metabolic pathway…
A: Triose phosphate isomerase catalyzes the interconversion between Dihydroxyacetone phosphate (DHAP)…
Q: 1. The dipole moment in a water molecule Which statement about hydrogen bonds is NOT true? A)…
A: The noncovalent interactions between molecules include electrostatic interaction, hydrogen bonding ,…
Q: Part II. Solving Genetics Problem. Do what is asked. Show your solution. A. Monohybrid Cross 1.…
A: Punnett square can determine the probability of each possible genotype (genetic makeup) and…
Q: Please use the graph below to explain the differences between the 2 enzymes whose activities are…
A: Enzymes are biocatalysts that increases the rate of a reaction by bringing down the activation…
Q: Is vitamin c portly soluble of immediate solubility or highly soluble and what are the mol 1-1
A: Vitamins are small molecule which are required for normal functioning of the body. These molecules…
Ff.161.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'
- Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOPMolecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of eachBelow is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5' DNA: mRNA: 5' AUG-CGA-GGC-CCU-UUA-UAA-CCC 3' codon: anticodon: amino acids:Refer to the DNA template strand below. Which of the following corresponds to the protein coding sequence portion of the corresponding mRNA? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3' O 5'- ATG CGA TTT GGG TGC TAG - 3' O 5' - AUG CGA UUU GGG UGC - 3' O 3' - GAC AUA GGA UCG UGG GUU UAG - 5' O 5' - CTA GCA CCC AAA TCG CAT TAG - 3' O 3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5'
- Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
