Q: What is the most effective type of vaccine and the preferred mode of entry? Why?
A: In the question, it is asked about the most effective type of vaccine and preferred way of entry.…
Q: To treat your infection, your doctor prescribes an antibiotic. This antibiotic inhibits the…
A: Several medications that suppress protein synthesis in bacteria are hazardous to eukaryotic host…
Q: The thoracic cavity and abdominal cavity are separated by the diaphragm and it controls inhalation…
A: The diaphragm is located below lungs, which is the major muscle involved in respiration. It is dome…
Q: Does maintaining excessive hip flexion limit the ability to accomplish full knee extension?
A: Hip flexion is the movement of bending your hip joint, bringing your knee up towards your chest.…
Q: Two parents with children with Down syndrome meet at a clinic. The Walters know that their son has…
A: Down's syndrome is an autosomal genetic disorder caused by trisomy at chromosome 21, which means…
Q: Put the labels to the location of the structure being described.
A: The correctly labelled diagram is shown in step 2.
Q: Explain original antigenic sin and how it can be detrimental to our secondary immune response
A: Original antigenic sin The tendency of the immune system to preferentially use immunological memory…
Q: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
A: An integrated tool used for conducting automatic and manual sequence alignment of DNA and protein,…
Q: After prolonged inflammation of the mucous membrane of the nasal cavity in the patient, changes in…
A: The main mucus membrane of nasal cavity has multilayered keratinised squamous epithelium.
Q: Fungi have many commercial applications. Many industrial compounds are byproducts of fermentation.…
A: Along with plants, animals, and others, fungi make up the kingdom. The variety of fungi is…
Q: Determine whether each label describes skeletal or cardiac muscle.
A: Check the answer below;
Q: You cross two pea plants that are heterozygous for the pea texture gene with alleles…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Which molecule in the gel is the smallest - A, B, C, or D? Explain how you determined this. B)…
A:
Q: Construct a cladogram showing possible evolutionary relationships among: Platyhelminthes Nemertea…
A: A phylogenetic connection is the examination of how organisms in a species or group have changed…
Q: ATP Oxygen Water Glucose light CO2
A: The reduced product - ATP The reactant that loses electrons ( oxidized ) - Oxygen The reactant…
Q: What is the cause of a heart attack?
A: The heart is the most important organ in the body which pumps the blood throughout the body. The…
Q: Chemical plants employees (which produce organic solvents that can dissolve phospholipids) often…
A: Phospholipids are a type of fat molecule found in the cell membrane of all living cells. They are…
Q: 1. From one colony of E.coli, you have purified the DNA of a recombinant plasmid. You have…
A: The DNA is measured at absorbance 260 and 280nm, and the ratio of two readings will tells the purity…
Q: is horizontal gene transfer? an example of a gene name for each of the following 1. What Provide a.…
A: Genes are the stretch of DNA that codes for a functional product either in the form of RNA or a…
Q: The mitochondrial membrane potential is an indicator of cell viability. Think about mitochondrial…
A: Mitochondria is the energy-generating organelle found in the cytoplasm of the eukaryotic cell. It…
Q: 20. How many unique gametes could be produced through independent assortment by an individual with…
A: Answer is B ..8 Here from the genotype data Aa, Bb, Dd are heterozygous and CC, EE are homozygous.…
Q: Different finch species have different beak shapes and sizes. What is this evidence of? different…
A: Darwin's finches are little land birds, 13 of which are unique to the Galapagos Islands. Despite…
Q: Demonstrate how males are at an increased risk of sex-linked recessive traits by crossing a female…
A: Hunters syndrome is an X-linked recessive disease. The X-linked means the disease-causing gene is…
Q: 24) The process of gametogenesis starts with a stem cell in the gonads and produces gametes used in…
A: Male and female gametes are formed by the processes of spermatogenesis and oogenesis, respectively.…
Q: Phylum Sarcomastigophora Labyrinthomorpha Apicomplexa Habitat Symmetry Germ Layer Locomotion…
A: Sarcomastigophora: kingdom- Protista, forms flagella and pseudopodia Labrinthomorpha: Kingdom-…
Q: Autnomic nervous system use arrows to show whether parasympathetic (p) or syspathic (s) fibers…
A: Various automatic activities like breathing, circulation of blood, digestion, urination etc which…
Q: Chronic sleep deprivation inhibited hypothalamic secretion of gonadotropin releasing hormone (GnRH)…
A: GnRH (gonadotropin-releasing hormone) is a hormone produced by the hypothalamus that stimulates the…
Q: Which of the following correctly describes a homologous pair of chromosomes in prophase of meiosis…
A: Meiosis is a type of cell division that forms four daughter cells from a single parent cell. It…
Q: A meadow is home to a population of plants of a particular species. Among these individuals are 125…
A: Given that allele for red flower (R) is completely dominant over allele for white flower (r). Also,…
Q: true or false All living photosynthetic organisms are capable of photosynthesis but not…
A: The process of producing glucose when carbon dioxide and water are present is called photosynthesis.…
Q: rice and beans fish and prawns turnips and carrots beans and corn broccoli and lemon are rich in…
A: A healthy diet ensures that your body receives all the vitamins, minerals, and nutrients it requires…
Q: The two reactions below and determine if they are exergonic or endergonic reactions +00 00 reactants…
A: Metabolic process are the processes in which bigger molecules are formed from small molecules or are…
Q: 25) For Each of the following receptors indicate which type of sensory receptor it a. Male silkworms…
A: Sensory receptors are specialized cells that perceives a certain kind of stimulus. The sensory…
Q: In the article called "Sexual dimorphism and male mating success in the tentacled blenny,…
A: Male and female differences in several animals are fairly apparent. "Sexual dimorphism refers to the…
Q: Which of the following is true about Glycolysis? a. endergonic reaction b. site is cytoplasm c. net…
A: Glycolysis Here a molecule of glucose is degraded in a series of the enzymes catalysed reactions to…
Q: What are prions made of? Why wouldn’t radiation be an effective choice to kill prions?
A: Prions are abnormal, pathogenic agents that are easily transmissible. They accumulate inside the…
Q: Hello, please read the attached Microbiology question and answer the question correctly. Please aim…
A: Antigenic drift produce the accumulation of a series of minor genetic mutations. Antigenic shift…
Q: definition of global warming what are the factors that cause global warming Consequences of global…
A: With the increase in harmful chemicals in the Earth’s atmosphere, there has been an increase in the…
Q: In a few sentences, describe how p53 guards the genome. Include at least two specific ways that p53…
A: The TP53 ( Tumor protein 53) also known as P53. This gene codes for cell cycle regulatory proteins…
Q: Smooth muscle tissue is involuntary in function. True False
A: Introduction The muscular system is primarily in charge of enabling movement of the body, upholding…
Q: Number of Birds 50 30- 20- 10. 0 7.3 7.8 8.3 9.3 9.8 A Beak Depth (mm) 8.8 A Caption: Distribution…
A: Introduction A biological population's heritable traits change over successive generations, and…
Q: propose a biomaterial-based drug delivery system for carrying targeted delivery of doxorubicin for…
A: A drug delivery system is a system used to deliver a drug to its intended target in a safe,…
Q: What are the common causes of failed genomic DNA extraction in bacterial cells?
A: DNA extraction is the process by which desirable DNA can be extracted from a particular cell.
Q: The discovery of sex-linked traits came from a genetic experiment on flies. A white eyed male fly…
A: We all know that traits are controlled by autosomes and sex-chromosomes.Now the trait can be either…
Q: Explain how this relationship between the solution in the Elodea cells (from #1) caused what you…
A: As we can clearly see in the above images, Elodea cells in saline solution appear crenated while…
Q: Describe what happens to the chromosome through Meiosis 1 and Meiosis 2, and indicate how this…
A: Homologous pairs means it is the pair of chromosome in which one of the set (chromosome) is…
Q: 4. Explain the following sensory pathway a. Exteroreceptor b. Interoreceptor c. prioprioceptor
A: Every receptors are essentially transducers, which means that when it receives a stimulus, it…
Q: Lab 11: Osmosis and Diffusion - Additional Resources. Bio 104 - McCabe C. Effect of Osmosis on Plant…
A: Elodea is a genus of five or six species of submerged aquatic plants of the frog's-bit family…
Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…
A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…
Q: Suppose a mutation occurs in the gene encoding eukaryotic RNA polymerase 1, 2 , or 3 that renders…
A: Abnormalities can vary from a single gene mutation to the addition or deletion of a whole chromosome…
Step by step
Solved in 5 steps
- Align two sequences: horizontal – GGAATGG, vertical – ATG, m= 2, mm = 0, g/o = -2, g/e = -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments. Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Click the shapes and move them using arrow keys (or drag). Click the shapes and right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in MS Word). 0000 Align and score all optimal alignments here. 0000For letter A, pls ILLUSTRATE (create an illustration or drawing) the DILUTION SERIES of the problem just like the sample on the 2nd image. Please read the instructions carefully as I have already posted this twice and the experts just copy-pasted the answers from my first post. I don't want to waste another post question for this one. Again, I NEED AN ILLUSTRATION and not just the computation/explanation through words so I can properly visualize the problem. WILL UPVOTE if I get what I need.2.1 INSTRUCTIONS — Do not copy in Google or Bartleby. Plagarize Checker will be use.
- What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool Best Local Alignment Search Tool Best Local Algorithm Search ToolAlign two sequences: horizontal – GGAATGG, vertical – ATG, m=1, mm = 0, g=-1. Use the table below for the NW matrix. Write down and score all optimal global alignments. Complete the NW matrix below and show the alignment paths. Use the arrows and circles for the matrix and paths. Click the shapes and move them using your keyboard arrow keys (or drag). Click the shapes and then right-click to copy/paste or click and use Ctrl + C to copy, then Ctrl + V to paste (in Windows MS Word). 0000 Align and score 4 optimal alignments here. the first line, v sequence in the second line and Each alignment should have h sequence individual scores for each alignment position in the third line.Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGHow are the gap penalties adjusted in the ClustalW multiple sequence alignment program to improve the algorithm? Indicate the logic only.This descriptor refers to the highest alignment score of all matched sequences to the sequence placed in the BLASTn search. Query cover Maximum score and Total score E-value Ident Accession number
- The algorithm or tool in MEGA that is used for multiple sequence alignment of nucleotide/DNA sequences. ClustalX T-coffee MUSCLE Clustal WList and Describe the algorithm of BLOSUM substitution matrix computation.This BLAST program performs the greatest number of searches for the same query sequence and database because of the greatest number of the reading frame translations. TBLASTX BLASTX BLASTN BLASTP PSI BLAST