This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions

This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

You have sequenced the genome of the bacteriumSalmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimuriumgenome to known proteins. You find a protein thatis 100 percent identical in the bacterium Escherichiacoli. When you compare nucleotide sequences of theS. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the meritsof nucleotide- versus protein-similarity searches inidentifying related genes?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function usinghaemoglobin as an example (8).5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
A sample of DNA with the sequence 5'- CTC GAG CGA AGC TCA ACC-3' he was obtained as a dry solid. The sample was dissolved in 1000 µl of deionized water ane mixed well. Ten microliters of the dissolved sample was then transferred to a new sampie tube and mixed with 990 ul of water, The dilute sample had A260 = 0.156. What was the concentration of the original sample (the solid dissolved in 1000 ul of deionized water)
DNA isolated from the bacterial virus M13 con-tains 25% A, 33% T, 22% C, and 20% G. Do these resultsstrike you as peculiar? Why or why not? How might youexplain these values?
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample oftheir experimental results is shown in the following table: A. E xplain how these results are consistent with the idea that thebacterial chromosome is circular.B. Draw a map of the bacterial chromosome that shows the orderof genes and the locations of the origins of transfer among thesedifferent Hfr strains.
Quantification of DNA can be done by using a Nanodrop, a UV spectrophotometer, by measuring its absorbance in units of optical density (OD) (see “Nanodrop Microvolume Quantitation of Nucleic Acids" video in Lab 3 on Laulima). DNA absorbs light most strongly at the ultraviolet wavelength of 260 nm. The absorbance of double stranded DNA (dsDNA) at 260 nm (A260) is used to estimate concentration, with 1.0 OD equal to a dsDNA concentration of 50 µg/ml. Using this information we can calculate the concentration of dsDNA in our extractions using the following formula: dsDNA concentration = 50 µg/ml x OD260 x dilution factor Using the formula provided above, calculate the concentration of dsDNA in an extraction that was diluted 20X and had an A260 reading of 0.64 OD. Show your work
You are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?
Electrophoresis is an extremely useful procedure when applied to analysis of nucleic acids as it can resolve molecules of different sizes with relative ease and accuracy. Large molecules migrate more slowly than small molecules in agarose gels. However, the fact that nucleic acids of the same length may exist in a variety of conformations can often complicate the interpretation of electrophoretic separations. For instance, when a single species of a bacterial plasmid is isolated from cells, the individual plasmids may exist in three forms (depending on the genotype of their host and conditions of isolation): superhelical/supercoiled (form I), nicked/ open circle (form II), and linear (form III). Form I is compact and very tightly coiled, with both DNA strands continuous. Form II exists as a loose circle because one of the two DNA strands has been broken, thus releasing the supercoil. All three have the same mass, but each will migrate at a different rate through a gel. Based on your…