Remaining Time: 1 hour, 07 minutes. 53 seconds.v Question Completion Status:A Moving to another question will save this response.Question 2Multiple Choice Question (suggested time - between 1 and 2 minutes):The Wobble Hypothesis proposed by Francis Crick postulates that...O A. Base pairing between nucleotides in the 1st codon and the 3rd anticodon positions does not strictly follow complementarity rulesO B. The two ribosomal subunits are loosely associated and wobble during translation.Oc Codorns and anticodons can pair when aligned in the same 5'-to-3' directionO D. Nucleotides in the 3rd codon and the 1st anticodon positions do not interact with each other.DEG can form a base pair with A.OF G can form a base pair with UA Moving to another question will save this response.Iyp

Wooble hypothesis was proposed by crisck and he explained degeneracy of genetic code. This…

Answered: The Wobble Hypothesis proposed by…

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 8SA: Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA

See similar textbooks

Similar questions

The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG AAG The original template for this process is: O DNA O TRNA O FRNA O MRNA
Multiple Answer Question (suggested time - up to 2 minuts): Which of the following statements about the genetic code is(are) true? DA Each codon encodes for one particular amino acid Oe. Genetic code contains 64 codons in total, with one start codon and three stop codons OC. Genetic code consists of nucleotide triplets - codons OD. Genetic code is non-overlapping O E. Genetic code is universal for all living organisms (except for mitochondria) OF. Genetic code is degenerate (redundant)
Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
Question:- A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA was used for translation. What is the probability of producing the following amino acids? NOTE: Answer in fractions only. 1. Threonine _____ 2. Asparagine _____ 3. Histidine _____ 4. Lysine _____ 5. Proline _____
From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
From the picture provided, which colored option (exon variant) will give me: 1. start codon 2. Stop codon Im not sure how to identify with exon out of the 15 exon varients provided which one has the start codon and which has the stop I need to filter these colored options in order to find my start codon and stop codon
Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed by condensation between the -NH2 function of the first amino acid (AA N° 1) and the -COOH function of the second amino acid (AA N° 2). C- Is generated by the ribosome during the process of transcription. D- Is an amino function. E- All possibilities given above are wrong.
Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Question Completion Status: Use the codon chart below to help answer the questions: Codons Found in Messenger RNA Second Base U C G Phe Ser Тyr Тyr Stop Cys Cys U Phe Ser Leu Ser Leu Ser Stop Trp Arg. U Arg Arg Arg Leu Pro His Leu C Leu Pro His Pro Gln Leu Pro Gln lle Thr Asn Ser U A lle Thr Asn Ser lle Thr Lys Arg Arg Met Thr Lys Asp Asp Val Ala - Gly Gly Gly Gly Val Ala Val Ala Glu Val Ala Glu A. Transcribe the DNA sequence TACTAAACACCGATT into mRNA (do not include any spaces in your answer): B. Where in a Eukaryotic cell does the process in part A take place? C. Translate the mRNA sequence from above into the amino acid sequence (in your answer, use the 3 letter abbreviations from the table above, and separate each amino acid with a space): D. If a molecule of DNA contains 22% thymine, what percentage of cytosine would it have? Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All An First Base DCAGD CAGUCAGUCAG Third Base

SEE MORE QUESTIONS

Recommended textbooks for you

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

Biology

ISBN:

9781305967359

Author:

STARR

Publisher:

CENGAGE L

SEE MORE TEXTBOOKS