The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). Tyr- s' CH₂ DNA Base O 01P=0 H Base
Q: Will dithiothreitol have the exact same effect on folded proteins or will the reaction undergo a…
A: Dithiothreitol (DTT) is a small redox reagent which is also known as Cleland's reagent. It is…
Q: The data in the table are used to create a calibration curve for the determination of RNA from ts…
A: In linear regression analysis, we examine whether one variable (called independent variable) can be…
Q: How important is biochemistry in making vaccines and curing diseases?
A: Vaccination is immunization. a nontoxic or nonvirulent preparation of antigenic material is…
Q: a) 500ml of 2M Tris-HCl buffer pH 8.9. Tris base MW is 121.14 g/mol. You will use concentrated HCI…
A: A buffer is a solution that can resist changes in pH when small quantities of acid or base is added…
Q: at is the effect of adding neurotoxins to the Motor neuron membrane and muscle membrane potentials?…
A: Introduction: Neurotoxins are poisonous substances that cause destruction to the nerve cells. It…
Q: Biolink 'Drugs and their Conformations' (a) Which drug is more likely to produce multiple…
A: A drug with confirmational flexibility is a good drug as it will produce more physiological effect.…
Q: 7. To what volume must 30 mL of a 2.5M NaOH solution be diluted to make a 0.4M solution?
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: What is something that allosteric effectors that alter the rate of catabolic or anabolic pathways…
A: Enzymes are biological catalysts that alter the rate of biochemical reactions. Allosteric enzymes…
Q: Identify the different functions of the genes coded in the lac operon region.
A: Operon is a set of linked genes that codes for proteins that are functionally related. lac operon is…
Q: What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction to the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Increased NADH concentrations in the liver encourage gluconeogenesis. What do you think about this…
A: Gluconeogenesis is glycolysis run backwards with three new enzymatically catalysed reactions where…
Q: 2.5 What is Chemio-osmotic gradient, and what is its importance in Metabolism
A: Chemiosmosis is the process by which the ions move by passive diffusion across a semi-permeable…
Q: Explain why condensed milk is not advisable to infants. 2. Enumerate the different kinds of milk.
A: Introduction Milk is the the primary source of nutrition for young mammals. It is a white colour…
Q: 15) The graph at right shows the results of reaction rate vs. substrate concentration for a…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Energy is stored long-term in the bonds of _____ and used short-term to perform work from a(n)…
A: A molecule is defined in chemistry as a grouping of distinct atoms. Water molecules (H2O) and carbon…
Q: please check if my answers are correct. Especially for prolin and Leucine
A: Amino acids are biomolecules that have an amino group and a carboxyl group attached to the same…
Q: What is the importance of biochemistry signaling to our health and development? How does it affect…
A: Biochemistry is the branch of science that is concerned with the chemical substances found in living…
Q: 8) Explain translation from the perspective of an mRNA transcript.
A: Translation is a process of converting mRNA transcript into polypeptide. This process occurs in the…
Q: Ceruloplasmin is a blue-colored monomeric oxidase found in mamma- lian blood plasma. It contains…
A: Ceruloplasmin is a copper containing globulin which helps in the transport of copper in the…
Q: Question 6 At pH 9.0, which of the peptides listed in Question #4 would bind tightest to a…
A: Hydrophobic interaction chromatography (HIC) separates molecules based on their hydrophobicity. HIC…
Q: PROTEINS 1. Give the general structure of amino acid. 2. Give the 20 amino acids (include structure,…
A: Amino acids are the building blocks of protein. They are joined by peptide bonds to make a…
Q: What are the monomers of DNA & RNA? What 3 parts do the monomers contain?
A: Introduction: Nucleic acids are large biomolecules that carry hereditary information for cellular…
Q: 1.1 Why do you think it was necessary for us to teach you about Metabolism in Biochemistry course…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Give a detailed description of the structure, characteristics, and functions of proteins
A: Proteins are the bio molecules which are made up of amino acids . They are the important bio…
Q: How does ATP releases the energy used by the Cell/What happens to ATP for the energy release/what…
A: ATP is also known as adenosine triphosphate. ATP is also called the energy currency of the cell. ATP…
Q: Regarding the physical condition (characteristics of the solution/environment) in which an enzyme…
A: Enzymes are large molecular weight proteins that catalyse biochemical reaction. An enzyme's…
Q: A.We have seen from history the role science has played in the prevention and control of diseases.…
A: Epidemiology : It is the study of diseases in a population, studying the reason , how it spread, why…
Q: HO 0 0 NH₂ НО.
A: The fundamental building blocks of proteins are called amino acids, which are made up of one…
Q: Algae are being studied as a source of lipids to be used as source of biodiesel as a liquid fuel.…
A: Given that algae uses H2O, NH3, CO2 in the presence of light to produce a compound CH1.8O0.5N0.2 and…
Q: Hierarchical Organization of Protein Structure Q3.1 Describe the properties of an amphipathic alpha…
A: With increasing complexity, protein structures can be arranged into four categories of hierarchies.…
Q: Fill in the blanks In the given reaction below, the amino acid HỌC NHỚ Coo NH4+ 2 0₂ H₂O₂ HC=0 coo…
A: Amino acids are converted to keto acids inorder to fuel the central process of the cell like…
Q: 14) Which of the following statements is true under the conditions provided: the enzyme…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Gluconeogenesis Q3.4 - Considering that gluconeogenesis requires a net input of 4 ATP equivalents…
A: Gluconeogenesis is the process of formation of glucose from non-carbohydrate sources such as…
Q: Intermediary metabolism includes all the reactions in an organism involved in generating and storing…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: What is the subject of the figure: What is the main message of the figure? Give a concise, complete…
A: Subject of the figure is point mutation of a base which leads to different translated product of a…
Q: 7. Vitamin B₂: coenzyme form, functional groups, mechanism of action, biological role, sources,…
A: The vitamin B complex is a set of water-soluble vitamins that includes riboflavin, commonly known as…
Q: Kindly answer the following questions. What is an enzyme? How enzymes are being classified and…
A: - An enzyme is a type of biological catalyst that is often a protein but can also be RNA. - In…
Q: Of the components in the hydrogels beads, which is the protein we are interested in measuring?
A: Hydrogel beads are cross-linked mesh of hydrophilic polymers which is composed of spherical shaped…
Q: c) A lysine residue in the active site of UstD is involved in forming a covalent Schiff base linkage…
A: UstD is an enzyme that decarboxylates specific acidic amino acids and allows the transfer of the…
Q: Classify the 13 known vitamins into water-soluble or fat-soluble vitamins. Water-Soluble Vitamins…
A: A vitamin organic molecules essential for the proper functioning of the body. They are…
Q: Differentiate the four qualitative tests for proteins BIURET, XANTHOPROTEIC, NINHYDRIN, & MILLON’S
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Match each weak acid with the pH value at which it would buffer. pH 3 ammonium (PK, of 9.25)…
A: pH is a negative logarithm of hydrogen ion concentration, or in other words, it is a scale which…
Q: 5. Fluoroacetate can be converted enzymatically to fluorocitrate by citrate synthase. Fluorocitrate…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate.…
Q: Why can nitrogen cross the membrane via diffusion through the bilayer and while protons require a…
A: Passive diffusion refers to the process by which small nonpolar, uncharged molecules dissolve into…
Q: 2. Aspirin can be absorbed into the blood through the cells lining the stomach and the small…
A: Aspirin is a drug that is used to reduce pain, antiinflammation, and fever. Aspirin is chemically…
Q: Why does the Asp-His ion pair contribute more energy at pH 6.0 than at low or high pH? At pH 10.0,…
A: pKa is the pH at which a weak acid is 50% dissociated into proton and conjugate base. At pH below…
Q: What is the purpose of a bacterial smear? What is the purpose of a bacterial smear? It spreads the…
A: Introduction: The bacterial smear technique is a routine procedure performed to prepare the…
Q: f you have 960 nucleotides, how many codons do you have?
A: Introduction DNA is a genetic material of our body. DNA is a self replicating molecule. The…
Q: Is the BSA a good stadard to use in the bradford assay?
A: Introduction Proteins are the most abundant macromolecule present in our body. Proteins are made up…
Q: Triacylglycerols Store Energy Q4.3 - Describe the three sources of triacylglycerols in humans and…
A: Introduction: Triacylglycerols are also known as neutral fats or triacylglycerides, which are esters…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Step 1 Lys Lys Ligase-AMP NH2 NH2 NH2 `NH2 PP АТР он он OH Step 2 Lys Lys NH2 NH2 NH2 NH2 DNA- OH OH Adenylate OH OH HO. Step 3 NH2 NH2 NH2 NH2 AMP Phospho- diester OH OH OH OH OH Describe the mechanism shown above for DNA Ligase. Describe the chemistry of each step How the enzyme appears or might facilitate the chemistry How the enzyme increases the reaction rate.Ultraviolet light can cause covalent linkages between consecutive pyrimidine bases in DNA (up to 100 per second in a single cell in sunlight!). These bulky lesions (i.e. cyclobutane pyrimidine dimers and 6-4 photoproducts), which inhibit DNA and RNA polymerases, are mostly reversed by CPD photolyase when light >300 nm is available to power the reaction. In the dark, however, which DNA repair system is best able to correct these errors? a) non-homologous end-joining b) mismatch repairc) nucleotide-excision repaird) base-excision repair e) homology-directed repair. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3In the Inhibition of telomerase activity. Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?Suggest a reasonable strategy for the specific phosphorylation of the5’ –OH group of a nucleoside.
- Explain why the active site of poly(A) polymerase is much narrower than that of DNA and RNA polymerases.Indicate the biochemical activities for the enzymes listed below. Use the lettered list of activities to mark the activities of the enzymes involved in DNA replication and transcription. E. coli DNA polymerase I Human telomerase E. coli RNA polymerase holoenzyme yeast RNA polymerase || E. coli primase A. 5' to 3' RNA-dependent DNA polymerase B. 5' to 3' DNA-dependent DNA polymerase C. 3' to 5' RNA-dependent DNA polymerase D. 3' to 5' DNA-dependent DNA polymerase E. 5' to 3' DNA-dependent RNA polymerase F. 3' to 5' DNA-dependent RNA polymerase G. 5' to 3' exonuclease H. 3' to 5' exonucleaseRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864
- Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.