The question is : Our intestinal tract is filled with probiotic bacteria which are the bacteria that help with food digestion and inhibit the growth of the pathogenic bacteria. Predict the possible effects of the overuse of the antibiotic on probiotic bacteria living in our digestive system and the possible consequences to an individual
Q: Cohort: Trematoda Order: Diplostomida Genus: Schistosoma Common Name: Blood Fluke
A: Introduction Blood fluke (Schistosoma) are the parasitic flat worm causes infection in human called…
Q: The tricuspid valve is located between the
A: Human heart is a muscular organ about the size of a fist. It is located just behind and slightly…
Q: Q4.10. A cell has been exposed to a poison that stops ligase from working. If all other enzymes are…
A: The mechanism wherein the genome's Dna is replicated in cells is known as DNA replication. Prior to…
Q: What is the most important reason for evolution of bacteria? Explain briefly. GiG of cancer by…
A: Bacterial evolution has continued over the billions of the years since the precambian time period.…
Q: List Darwin's Postulates and show which ones are random and which ones are deterministic
A: Evolution Evolution is a continuous process involving change which occurs due to the adaption of new…
Q: Kevin and Sonia want to prepare a bean salad for the class picnic. They buy a package of dried…
A: Introduction: To soak beans the old-fashioned manner, cover them with 2 inches of water, 2 teaspoons…
Q: Mary is 65 years old and has just been told that she has osteoporosis. What is osteoporosis and how…
A:
Q: STR ⒸDigital Frog International A B
A: Introduction The heart, blood vessels, and blood are all part of the blood circulatory system,…
Q: Please observe the tetrad of duplicated homologous chromosomes. Have a single crossover take place…
A: Alleles are the alternative form of a gene that are located on the same locus of Homologous…
Q: How does genetic analyses of fossils help us understand human evolution better than just examining…
A: following is description of how genetic analysis of fossils help understanding human evolution…
Q: What kind of information What is the application is derived from polyphasic taxonomy? of polyamines…
A: Bacterial taxonomy is made up of the interconnected fields of classification, nomenclature, and…
Q: Do you believe that chimpanzees should be classified in the same family and/or subfamily as humans?…
A: Chimpanzees and humans are almost identical. The difference between two humans would more or less be…
Q: Answer the following about low carbohydrate diets: true false Is made up of a large about of nonfat…
A: Introduction Carbohydrates form important biomolecules in the diet of every organism. These…
Q: the liquid viscosity is density intendent. True O False during the diastolic of the cardiac cycle…
A: Introduction When the membrane potential of a specific cell region rapidly rises and falls, it is…
Q: Name five functional traits of microorganisms. What dose the functional diversity describe? Do we…
A: Functional traits of the microbes describe individually expressed phenotypes or characteristics of…
Q: Why does the hydrolysis of ATP release so much energy? Because very strong bonds are required…
A: The mechanism of ATP hydrolysis is an exergonic one. It generates adenosine diphosphate (ADP),…
Q: Q3.9. For which of the following is potential energy DECREASING? (Hint: Click here to see an…
A: INTRODUCTION Potential energy is stored in living cells in the form of ATP.
Q: Which of the following is true of overexploitation? Select ALL that apply. a Only animals are…
A: Overexploitation is the exploitation of a resource to the point of depletion. It occurs when the…
Q: Fats, cholesterol and waxes are examples of which type of biomolecules? * A. Carbohydrates B.…
A: Biomolecules are chemical compounds found in living organisms. These include carbohydrates, lipids,…
Q: During the process of anaerobic cellular respiration, the final electron accepter in the electron…
A: Anaerobic respiration is the respiration process similar to aerobic respiration but it does not use…
Q: Explain why bacteria are limited to growth within a given temperature range? Explain why bacteria…
A: Bacteria are single-celled organisms with a small size. Bacteria can be found practically everywhere…
Q: Description Unicell or multicell? Cell wall? Nuclear envelope? Membrane bound organelles? Bacteria…
A: Introduction :- Bacteria are minute, single-celled organisms that can be found in large numbers in…
Q: Clearly distinguish between the 3 parts of glycolysis.
A: The breakdown of glucose to provide energy is known as glycolysis. Pyruvate, ATP, NADH, and water…
Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…
A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…
Q: Name: - In humans, being a tounge roller (R) is dominant over non voller (r). A man who is a…
A: As per BNED rule only first question should be answered, so kindly submit the other question…
Q: RISA
A: The full form of RISA is Ribosomal RNA Intergenic Spacer Analysis. This type of analysis is referred…
Q: Omics techniques 100?
A: Omics techniques is a technique which can measure the total composition of a specific biochemical…
Q: Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag…
A: This is the subsequent immune response after the primary immune response, also known as the…
Q: Which of the following regarding statements Darwin and his theory of evolution is false? Darwin…
A: Darwin contributed to the science of evolution. Darwin established that current species of organisms…
Q: Cucumis sativus (cucumber) is a diploid plant with 7 chromosome pairs. Determine the following as…
A:
Q: 15. In which of the following forms is energy immediately made available for the use of living…
A: Each body cells need energy in order to perform various body or metabolic functions. The energy can…
Q: In table 21.1, the effects of injection of different types of RNA into wild type mice was examined.…
A: miRNA(micro RNA) is type of non coding, single strand RNA. It involves in gene silencing and…
Q: The following chemicals are involved in electron transport. Which of these chemicals has the…
A: Introduction: The electron transport chain, also known as the respiratory chain, is found in the…
Q: The Riccia is a bryophyte because: ○ It has multicellular sex organs with a sterile jacket and lacks…
A: Bryophyte These are the group of non-vascular plants that have no roots or vascular tissues. These…
Q: Most of you have seen oak leaves fall on driveways and on streets when fall arrives. These pigments…
A: Tannin is a water-soluble poison that is found in oak leaves. If you were to rub your skin with oak…
Q: Briefly explain, using a concrete example, how allopatric speciation can lead to the appearance of a…
A: Speciation is the process by which new species emerge. Speciation occurs when an ancestor species…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: What is the proper term for the group of reproductive cells that pass genes on to the next…
A: Reproductive cells are formed through meiosis. Meiosis is reductional division.
Q: 4. In humans the primary purpose of cellular respiration is A the removal of CO₂ from animal cells…
A: Introduction :- The metabolic pathway that breaks down glucose and produces ATP is known as cellular…
Q: A rise in the intracellular Ca2+ concentration causes muscle cells to contract. in addition to an…
A: Introduction :- Calcium pumps are a type of ion transporter found in all animal cells' cell…
Q: Match the water soluble vitamin with its deficiency megaloblastic anemia, cognitive decline, age…
A: Vitamins are the key component of cellular pathways for example- hydroxylation of collagen protein…
Q: 3. Draw a photosystem and label the parts.
A:
Q: 2. A learner carried out an experiment on water loss from leaves. The learner wanted to find out…
A: Introduction Leaf base, leaf lamina, and petiole are the three primary elements of a leaf. Simple…
Q: What are the basic components of a Fluorescence Microscope and what are the functions of each? Are…
A: Microscopes are laboratory instruments that are used to view and study things that cannot be seen…
Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…
A: In our Desire primer it is 15 nucleotide long however on gels there are only 10 bands are present…
Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…
A: Given: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals…
Q: Identify the mismatched pair. (Select all that apply.) a. type I hypersensitivity: mast cells,…
A: Different types of hyper sensitivity are the undesirable reactions produced by the normal immune…
Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…
A: Here the test cross that produced 1572 offspring was conducted between k/k+ l/l+ m/m+…
Q: Which of the following describes cardiac muscle tissue? Select all that apply. a striated b…
A: Introduction Cardiac muscles, these types of muscle are found only in the walls of the heart. It is…
Q: How is our concept of human form and function today affected by inventors from the seventeenth to…
A: Introduction :- Humans are the most numerous and ubiquitous primate species, distinguished by…
Step by step
Solved in 2 steps
- For each of the following examples, indicate whether the drug is acting on physical process, chemical process or enzymatic system (your answer should be only; Physical, Chemical or Enzymatic). Group of answer choices 1. A drug is used as an antidote in lead poisoning and acts by binding to lead particles in body (chelation therapy). 2. A drug acts to reduce flatulence and acts by reducing the surface tension of intestinal gas bubbles in the GI tract (e.g. Simethicone). 3. A drug competes with alpha-glucosidase in intestine to reduce glucose conversion from disaccharides (e.g. Acarbose).Give three recommendations on how to handle potential vitamin and mineral deficiencies during this pandemic based on your fundamental understanding of vitamins and minerals, personal experience with various levels of quarantine, and knowledge of or experience with the impact of this pandemic on the economy. Explain why you chose those three recommendations.Directions Consider the following article: Revisit gut microbiota and its impact on human health and disease Our gut microbiome has been shown to be a key modulator of human health. The organisms that are part of our normal gut microflora have been proven to be involved in many aspects of our overall health. There are more microbes in and on us than we have human cells. Not only bacteria, but fungi, viruses, and other microbes are present in and on the human body. Initial Post For your initial discussion post, research one of the major human diseases, longevity, or infant health that have been shown to be impacted by our gut microbiota and discuss the accuracy and validity of the claims. How can we best utilize this knowledge in our own lives? Can we help those we love with their health issues by helping to modify their gut microbiota? Include supportive information from at least one credible source and the reference for your source in APA format.
- One of the most common observations in many metabolic diseases is: An increase in the diversity of gut microbe species A decrease in general inflammation levels A decrease in the diversity of gut microbe species A specific causal link between a single bacterial species and a diseasehow do I identify the scenarios According to the different conditions? It is the night after Halloween and you have had a great night of gather treats from your local community! You notice that you have gotten a lot of sour candy in your bag this yearEvery time you eat a sour candy, you notice that your stomach feels nauseous. To help you out, your sister suggests that you to drink Gatorade to make your stomach feel better. You do this a total of 10 times (you eat sour candy, get nauseous, and drink Gatorade to feel better).After many trials of this, having some Gatorade starts to make you feel nauseous. Unconditioned Stimulus (UCS) Unconditioned Response (UCR) Conditioned Stimulus (CS) Conditioned Response (CR)An individual is placed on antibiotic therapy. For which vitamin deficiency is he/she at greatest risk? Why might this occur? How can this be prevented? Question 3 options:
- No one would dispute the facts that the use of antibiotics is extremely beneficial. Why then are there currently discussions around the idea that we as a society should be limiting our antibiotic use? What are the pros and cons of utilizing antibacterial and antimicrobial products (NOT antibiotics) on a daily basis? Do you agree or disagree that the use of antibiotics should be reduced and if so, how should it be done?The patient is a 44-year-old, overweight female who presented to her primary healthcare provider yesterday with complaints of recent episodes of shortness of breath that occur with minimal activity such as walking a flight of stairs or with increased stress. Her symptoms are relieved with rest. She denied any chest, arm or jaw pain but did have some diaphoresis with one or two episodes. - She attributed her symptoms to her smoking one pack per day for the past 20 years and obesity. - She has gastroesophageal reflux controlled with ranitidine and has a history of elevated cholesterol (252), HDL of 46, and LDL of 180. Her triglycerides were 140. - She drinks three to four caffeinated beverages per day and denies alcohol use. -In addition, she has a history of situational anxiety since her mother's death and hypertension controlled with atenolol. - Her surgical history includes total abdominal hysterectomy six years ago and right carpal tunnel surgery two years ago. The patient's…A 37 year old man develops a recurrent episode of pseudomembranous colitis shortly after completing an initial course of oral metronidazole therapy. Which of the following best explains the recurrence? The bacterial strain can form spores that persist in the gastrointestinal tract Other gastrointestinal flora have degraded the metronidazole The patient has an underlying gastrointestinal tract disorder Systemic therapy is necessary to eradicate this infection
- Meal Planning and Preparation for Patients Suffering from Different Diseases Diet is a major factor is preventing damage of the organs in the body. It is also important to be aware of the food items to be allowed and restricted to avoid further complications. Please discuss the characteristic, dietary management and rationale of the following disease condition.Answer the following questions in complete sentences and paragraphs. Draw the diagram by hand: Diagram the 5 step pathogenesis cycle for coli O157:H7, an extracellular, intestinal pathogen acquired by consuming contaminated food/water. Be sure to include the role of exoenzymes and the Shiga exotoxin in your diagram. Explain the pathogenesis of Listeria monocytogenes. Be sure to include temperature regulation, intracellular growth, and at risk groups in your discussion.Filipina’s 3-year-old daughter, Manila, was brought to a clinic. The doctor diagnosed Manila with a severe dry cough. A mucolytic solution was prescribed and to be administered for seven days. The prescription states, “Mucolytic, XYZ Brand, 60 ml, dosage-1 teaspoon 1 hour before a meal, 3x a day”. Now, Filipina is skeptical of the dosage mentioned in the prescription regarding the proper amount of medicine to be administered to her daughter. If you are Filipina, how are you going to approach the case to make sure that your daughter will not have an overdose or underdose of the medicine prescribed? Apply the principle of accuracy and precision in the problem.