The original DNA sequence was CCGGAATT. It was replicated. Which of these newly replicated DNA molecules has a base-substitution error? 5'CCAGAATT3' 5'CCGGGAATT3. 5'CCGAATT3'
Q: Using proper convention, provide the amino acid sequence for the following peptide. O=C…
A: There are four classes of biological macromolecules- nucleic acids, proteins, lipids and…
Q: Although all of these play a part, the most important factor which drives protein folding is: a)…
A: The objective of the question is to test the understanding of various concepts related to proteins,…
Q: Arsenate (ASO) closely resembles phosphate in structure and reactivity. However, arsenate esters are…
A: Arsenate mimics the structure of phosphate. Because of this, arsenate binds to the phosphate binding…
Q: Conversion of glucose-6-phosphate to fructose-6-phosphate is a/an ... reaction O group transfer…
A: Glycolysis is an essential metabolic mechanism in cells that breaks down glucose into two pyruvate…
Q: Give a possible nucleotide sequence for the template strand of the gene that codes for this…
A: There are four classes of biological macromolecules - nucleic acids, proteins, lipids and…
Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…
A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…
Q: Select the statements that describe genomic DNA libraries. DNA fragments are cloned into vectors.…
A: DNA libraries are catalogs of genetic information. DNA libraries are of different types, the two…
Q: Mutations leading to changes that can be inherited by the next generation have be introduced at the…
A: There are four classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: 2. The structures of different coenzymes are given below. (A) Write the name of the coenzyme; (B)…
A: In biological systems, most of the reactions are catalyzed by enzymes which are proteins that help…
Q: Answer the following using the structure: a. Is this a purine or pyrimidine? b. Is this a…
A: Deoxyribose and ribose are aldopentoses which after phosphorylation form deoxyribonucleotide and…
Q: The Cori cycle involves the: Question 44 options: A) conversion of glucose to lactate in liver and…
A: The metabolic pathway known as the Cori cycle, or lactic acid cycle, was discovered by Carl…
Q: The purpose of fermentation reactions is: a) to provide more glucose for glycolysis b) to…
A: The purpose of fermentation reactions is to keep glycolysis going under low oxygen conditions by…
Q: What is the relative activity of the following mineralocorticoid drugs? A. A>C>B>D B. A>B>C>D…
A: The general structure of mineralocorticoids is given below.Modifications to this structure can…
Q: Part A Why does it make biochemical sense that chaperones recognize hydrophobic surface area? What…
A: There are four classes of biological macromolecules- proteins, nucleic acid, lipids and…
Q: As a result of rotation about six of its bonds, DNA can exist in a variety of forms. Determine…
A: There are 3 major DNA variants. They are A-DNA, B-DNA and Z-DNA. In all these variants, A pairs…
Q: Why do ketoses go dehydration reaction much faster than aldoses in Seliwanoff’s test when aldehyde…
A: Seliwanoff's test is a chemical test used to separate aldoses and ketoses, explicitly between…
Q: Name the given lipid molecule below:
A: Lipids are a diverse group of biomolecules that perform structural and functional roles in our body.…
Q: 1. Ifa Lineweaver-Burk plot gave a line with an equation of y=0.25 x +0.34, what are the values of…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions.Most enzymes are…
Q: Carbohydrate Chemistry Overall, what are the reactions and characteristics of sugars or…
A: There are 4 classes of biological macromolecules: proteins, nucleic acid, lipids and carbohydrates.A…
Q: The following molecules act as either inhibitors or activators of the enzyme that converts…
A: Pyruvate kinase catalyzes the dephosphorylation of PEP to pyruvate. It is coupled to the…
Q: In chromatography, each solute has an equilibrium partition coefficient K, = si/c₁, where s, is the…
A: (a) Mean Residence Time:The mean residence time is the average time a solute molecule spends in the…
Q: Part A Identify which of the carbons in this molecule are chiral and which are not. Drag the…
A: Chiral carbon:-Chiral carbon is tetrahedral carbon (having SP3 hybridisation) which has four…
Q: D-galactose (Figure 2) reacts with methanol. Edit the structure of D-galactose drawn below to create…
A: Carbohydrates such as monosaccharides reacts with methanol in the presence of an acid to form acetal…
Q: good leaving group poor leaving group three four five exygen sulfur imine amide Cysteine can react…
A: The semiessential proteinogenic amino acid cysteine (symbol Cys) has the formula…
Q: 4. Which of the following is a correct description of the peptide segment shown below? A. The amino…
A: Amino acids joined by peptide bonds form compounds known as peptides. These macromolecules, which…
Q: The bonds that hold a cytoskeletal polymer together are best described as... -Covalent,…
A: The cytoskeleton is a network of different protein fibers that provides many functions: it maintains…
Q: chromatography
A: Hydrophobic interaction chromatography segregates molecules by their degree of hydrophobicity.The…
Q: Why must NH3 be transported as part of an amino acids vs. being released into circulation? What…
A: Ammonia is produced in all tissues of the body during the metabolism of amino acids and other…
Q: Enzyme X follows Michaelis-Menten kinetics. You add an inhibitor to your enzyme and you notice that…
A: The Michaelis-Menten equation is used to describe the kinetics of enzyme catalyzed reactions. It…
Q: If the serine phoshorylated by Protein Kinase A (PKA) on phosphofructokinase-2 (PFK-2) were mutated…
A: Glucose levels in the blood are maintained by glycolysis (catabolism) and gluconeogenesis…
Q: Alcohol dehydrogenase catalyzes the oxidation of an alcohol to the next highest state of oxidation,…
A: The question is asking us to explain how the enzymatic activity of alcohol dehydrogenase, which…
Q: Eicosanoids and endocannabinoids, which are hormone-like substances, are made from which fatty acid?…
A: The objective of the question is to test the understanding of various concepts related to…
Q: Answer the following problem and explain your answer for better understanding Which steroid affects…
A: A physiologically active polycyclic organic molecule with four fused rings organised in a certain…
Q: The diversity of functional groups on sugars that can form glycosidic bonds greatly increases the…
A: Peptides are the compounds formed from the amino acids.Amino acids are the building blocks of…
Q: at R #314 J K not
A: Catalytic efficiency of enzymatic reaction (turnover)For catalysed reaction the Kcat is used where…
Q: E3 of the pyruvate dehydrogenase complex performs which main function? A) removing a proton from…
A: The objective of the first question is to identify the main function of E3, also known as…
Q: Consider a small protein containing 90 amino acid residues. The protein backbone will have 178 bonds…
A: Random coils are secondary structures that lack any regular pattern. Examples of secondary…
Q: In hepatocytes, glucagon signaling leads to release of select one, which leads to the activation of…
A: Hepatocytes are responsible for regulating blood glucose level. When the blood glucose level…
Q: 6. Proteins contain other amino acids that can compete with cysteine and react with bromoacetamide.…
A: There are four classes of biological macromolecules: protein, nucleic acids, lipids and…
Q: Which of the following statements is not true about the catalytic triad in chymotrypsin? Group of…
A: The objective of the question is to identify the incorrect statement about the catalytic triad in…
Q: A 25-year-old man has a lifelong hemorrhagic diathesis. The PT and bleeding time are normal, but the…
A: Hemorrhagic diathesis is a condition characterized by a tendency to bleed excessively or for an…
Q: Which C-C is most likely to be broken by aldolase? CH₂-OPO3²- I C=O I HO-C-H I H-C-OH H-C-OH…
A: Enzymes are proteins that catalyse chemical reactions.. They convert molecules called substrates…
Q: Question 3 (1 pt): Which positions in adenine and guanine have the potential to form hydrogen bonds…
A: There are four classes of biological macromolecules; nucleic acid, proteins, lipids and…
Q: The carbohydrates (CHOs), with a general formula of (CH₂O)n, are rich in hydroxyl groups. This…
A: Carbohydrates are the most abundant of all biomolecules present on the earth. Likewise, they play a…
Q: When substrate concentration [S] << Km, the rate of an enzymatic reaction is increased by A.…
A: In enzymology, the substrate concentration at which an enzyme operates at half of its maximal…
Q: 4. Two common buffers in biological research are PBS and TBS. What are the compositions of these…
A: Hello! Thank you for the question. Due to time constraints, we will be able to provide the solution…
Q: 1. Complete the following table. ✔✔✔✔ Functional Group Name Aldehyd e Phospha te HO I () Structural…
A: There are four classes of biological macromolecules. They are nucleic acids, proteins, lipids and…
Q: The pharmaceutical applications of the compound shown HO OH OH OH OH O A. Chemical substrate for…
A: Sorbitol less commonly known as glucitol.It is a sugar alcohol with a sweet taste which the human…
Q: The hormone which regulates pH in the intestine is called: a) cholecystokinin b) secretin c)…
A: The objective of the first question is to identify the hormone that regulates pH in the intestine.…
Q: odd-chain fatty acids are metabolized down to propionyl-CoA (a 3 Carbon unit). This is converted in…
A: The fatty acids are the building blocks of the fat in our bodies and in the food we eat.During…
Please don't provide handwritten solution
Step by step
Solved in 3 steps
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.
- Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5' O 5' GCG TCA CCT GTA AAG 3' O 5' GAA ATG TCC ACT GCG 3' O 5' GCG UCA CCU GUA AAG 3' O 5' GAA AUG UCC ACU GCG 3'A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 onlyA linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC–3' Fragment 2: 5'-ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5'-CCCTAGTTAAAAC-3' Fragment 4: 5'-ACCGCAATACCCTAGTT-3' Fragment 5: 5'-ACCGCAATACCCTAGTTAAA-3' Fragment 6: 5'-ATTTACCGCAAT-3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.
- What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5 O 3- GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O 5- GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGA certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center AccessibilityFor the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTAT