The following table depicts characteristics of five prokaryotic species (A- E). Use the information in the table to answer the following question. Trait Plasmid Species A R Species B None Variable Species D F Species C Species E None Gram Staining Variable Results Nutritional Mode Specialized Metabolic Pathways Negative Negative Negative Chemohete ro- Chemoauto- Chemohete ro- Chemohetero- Photoauto- troph Anaerobic nitrogen fixation and aerobic photosystems I and II Thylakoids troph Anaerobic troph Aerobic methanotroph methanogen (obtains carbon and energy from methane) troph Anaerobic butanolic fementation troph Anaerobic lactic add fermentation Other Features Fimbriae Intemal membranes Flagellum Pili Which two species should have much more phospholipid, in the form of bilayers, in their cytoplasms than most other bacteria?

The following table depicts characteristics of five prokaryotic species (A- E). Use the information in the table to answer the following question. Trait Plasmid Species A R Species B None Variable Species D F Species C Species E None Gram Staining Variable Results Nutritional Mode Specialized Metabolic Pathways Negative Negative Negative Chemohete ro- Chemoauto- Chemohete ro- Chemohetero- Photoauto- troph Anaerobic nitrogen fixation and aerobic photosystems I and II Thylakoids troph Anaerobic troph Aerobic methanotroph methanogen (obtains carbon and energy from methane) troph Anaerobic butanolic fementation troph Anaerobic lactic add fermentation Other Features Fimbriae Intemal membranes Flagellum Pili Which two species should have much more phospholipid, in the form of bilayers, in their cytoplasms than most other bacteria?

Principles Of Pharmacology Med Assist

6th Edition

ISBN:9781337512442

Author:RICE

Publisher:RICE

Chapter15: Antibiotic Agents

Section: Chapter Questions

Problem 19RQ

See similar textbooks

Similar questions

The following table depicts characteristics of five prokaryotic species (1-5). Use the information in the table to answer the following question. Species 1 Species 5 None Trait Plasmid Gram Staining Results Nutritional Mode Species 2 None Species 3 R Species 4 IF Positive Positive Negative Negative Negative Chemohetero- Chemoauto- troph Chemohetero- Chemohetero- Photoauto- troph Anaerobic troph troph troph Aerobic Specialized methanotroph Metabolic (obtains carbon Pathways and energy from methane) Anaerobic methanogen Anaerobic alcoholic fermentation Anaerobic lactic nitrogen fixation acid fermentation and aerobic photosystems I and II Other Features All of the species shown have a cell wall that consists partly of an outer membrane of lipopolysaccharide EXCEPT Internal membranes Fimbriae Flagellum Pili Thylakoids species 1 only species 2 only species 3, 4, and 5 species 1 and 2 only 0 O 0 0
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Strepto-and Staphylo- are prefixes that describe: Ocell arrangement virulence spore location morphology
ean.khpcontent.com/biology/page/ch23pretest?type question-list&page_type-6896389 D YouTube * Maps raprer 1 Ablgall CAMERON- October 03, 2021 12:45:43 PM Return to Site 4. 56 1 3 9 10 11 12 13 14 15 16 17 (15 of 17) Match each group in the left column with the corresponding grouping in the right column. Marchantiophyta А. Non-vascular plants Lycopodiophyta В. Seedless vascular plants С. Pterdiophyta Non-vascular plants D. Seedless vascular plants Bryophyta E. Non-vascular plants Anthocerophyta Note: Clicking any button other than the Save Answer button will NOT save any changes to your answers! Save Answer Skip Question I Am Finished/Submit for Grade
Select the organism that matches each description. Some answers may be used more than once, and some not at all. Make sure that you scroll in the selection box, there are 13 possible matches. Was on Romaine lettuce sent from Yuma, AZ causing food-borne diarrhea Forms chains of Gram positive cells and is a common cause of tooth decay. A member of the normal vaginal flora that can overgrow at high pH Protozoan that is resistant to normal levels of chlorine used to disinfect the water Is salt tolerant and can inhabit the skin of healthy individuals, but can cause furunculosis Known as group B streptococci, is beta hemolytic and CAMP test positive Protozoan in stagnant water causing primary amoebic meningitis Psychrotropic, Gram positive rod transmitted in dairy causing systemic disease Escherichia coli O157:H7 Streptococcus pneumoniae Candida albicans Pseudomonas aeruginosa Cryptosporidium parvum Streptococcus mutans Streptococcus agalactiae Staphylococcus aureus Campylobacter jejuni A
Karelina Bologicel Supply Company Give the DOMAIN for these organisms
Given the groupings of microorganisms, please indicate within the prescribe column whether these characteristics belongs to the group. Indicate your answer by writing Y if a characteristic and N if a non-characteristic. If the characteristic is not true to all members of the group, then write NY
express some basic evolutionary relationships among groups of microorganisms i need other answers please explain well do not copy from others or i will downvote
Explain the different role, association and impact of Lactobacilli in food microbiology that you have studied. Use maximum 100 words.
Why is the term prokaryote considered an inadequate descriptor by some microbiologists?
Shigella Sonnei A short paragraph on the habitat of the organism. A short paragraph on the special characteristics of the organism. And a short paragraph on the clinical significance of the organism. please attach references!
Which of the following refers to a bacterial species with variations? Atypical Genus Diversified Serotype Subcultures