The diversity of modern vertebrates was shaped in partby mass extinctions. The most severe extinction eventwe know of occured at the border between the Permianand Triassic periods about 250 million years ago. Anestimated 96 percent of the marine species and 70 percentof land species disappeared in what is sometimes called“The Great Dying.” The cause of this mass extinctionremains under investigation. Suggested causes includean asteroid impact, extreme volcanic activity, or a sudden release of carbon dioxide from deposits on the sea floor. Which groups of vertebrates were present when this mass extinction event occurred? Which evolvedafterward?

Q: Shown below are photomicrographs of Rhoeo tradescantia cells undergoing meiosis. Answer the…

A: Introduction Mitosis is the division of replicated chromosomes into two new nuclei during the cell…

Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…

A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…

Q: Explain the difference between resolution and mag­nification.

A: Introduction :- The term'resolution' is used in microscopy to describe a microscope's ability to…

Q: Why are there so many marsupials in Australia but not in South America?

A: Australia is the kingdom of marsupials containing marsupials such as kangaroos, koalas and wombats.…

Q: True or False: Plant viruses like animal viruses also utilize the cell’s machines to create viral…

A: NADP and ATP are utilized along with the carbon dioxide by plants. Later, the production of glucose…

Q: Compare and contrast the adaptive structures of the insect ectoparasites and the endoparasites.…

A: Ectoparasites are organisms that live just on skin of humans and other animals and are classified as…

Q: describe the mechanics of breathing (quiet and forced)

A: In order to provide oxygen to the tissues and remove carbon dioxide from the blood, the actions of…

Q: When Charles Darwin discovered the various finch species on the Galápagos islands, he was surprised…

A: Introduction :- The presence of certain traits gives a population a competitive edge, making it more…

Q: Statements: I. Thymosin acts to prevent rate of actin polymerization. II. Loss of tight junction…

A: This question is about cells.

Q: Sex linked 6. traits are those found on the chromosomes determining gender, and show up more often…

A: Multiple allele is a condition and according to that, In a gene there are more than two alternate…

Q: Please help me with questions 1 & 2 1. In photosynthesis, the carbon in CO2 is ______ to form…

A: Photosynthesis is the physiochemical process.

Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…

A: Several types of techniques are incorporated in the molecular biology to get more desirable results…

Q: In his discussion of ethics and the environment, Velasquez concludes that Select one or more than…

A: Manuel Velasquez is a business ethics professor who also teaches about the societal, legal, and…

Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…

A:

Q: 6. The uptake of DNA into the bacterial cell is facilitated by_ a. Calcium chloride b. Magnesium…

A: DNA is an organic molecule that includes genetic information as well as instructions for protein…

Q: three different types of loss of function mutations and in each case explain how the mutation exerts…

A: A mutation is any alteration of the base sequence of the DNA or RNA. Since mutation alters the base…

Q: errors

A: Genetic disorder- it occur when a mutation affects our genes or chromosomes. it can affect one or…

Q: what structure is present in both plant and yeast cells, but not in a bacterial cell?

A: Introduction :- Yeasts are single-celled fungi that produce daughter cells either by budding…

Q: Question 64 The vertebrates that lack jaws are called O rays. O turtles. O lampreys. O eels. MacBook…

A: Since you have asked multiple questions from different topics at a same time we will answer only 1st…

Q: Insects are capable of fairly advanced behavior. e and briefly explain an example of advanced insect…

A: Insects are invertebrates belonging to the phylum Arthropoda and class Insecta. they are the largest…

Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…

A: In the development of antibacterial drugs, when two or more drugs are tested together…

Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…

A: Answer :- Option (C) is correct. - Temporarily lost part or all of its secondary and tertiary…

Q: The 20th century would witness the new anti-biotic revolution that would save millions of lives.…

A: Antibiotics changed medical practice by significantly decreasing the morbidity and mortality…

Q: . In order for a phage to infect the host bacterium, it is preferred that the cell wall is newly…

A: In order for a phage to infect the host bacterium, it is preferred that the cell wall is newly…

Q: 2. If the yeast do not grow on your selective media plates, describe at least two different errors…

A: When growing yeast in a selective plate the major error in various cases is the contamination of…

Q: 1- Why was the T4 and E.coli mixed together in top agar and then poured on the plate instead of just…

A: T4 bacteriophage and E. coli mixture using in plaque assay :-

Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…

A: A tree like or comb like taxonomic relationship among different group of organisms is called…

Q: State specific factors that contribute to the rapid evolution of bacteria and archaea.

A: All living species are regularly classified into three fundamental domains: Bacteria, Archaea, and…

Q: explain why biodiversity is the life insurance of itself?

A: Biodiversity- Biodiversity is the biological variety and variability of life on Earth.

Q: In case of a plant virus going viral, what actions do you think should be made to improve our food…

A:

Q: proces: transport through a membrane may be described which of the following? A. the movement of…

A: INTRODUCTION The cell membrane's chemical nature makes it very flexible, making it the ideal border…

Q: True or False:  1. Lytic viruses utilize the host’s machines to construct their viral components…

A: The term 'virus' is derived from the same word in Latin, meaning venom or poisonous fluid. It was…

Q: Discuss the transpiration-cohesion-adhesion theory of water movement in the plant system.

A: According to many scientists living cells have no role in ascent of sap. Rather some physical…

Q: QUESTION 7 SR proteins bind to splicing enhancers and activate splicing by recruiting spliceosome…

A: SR proteins hepls in pre mRNA splicing. SR protein has two binding domain.  RNA recognition motif…

Q: signal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with…

A: URA3 is often used in yeast research as a "marker gene", that is, a gene to label chromosomes or…

Q: A 30 year old female who moved to the U.S. from Thailand 25 years ago has just suffered from an…

A: Answer :- Option (C) is correct. - Aging.

Q: v A compound required for precipitation of.DNA A. Carbonic acid v One of the products released when…

A: 1. A compound required for precipitation of DNA- B.Ethanol.   2. One of the product released when…

Q: Describe the features of the fluid mosaic model of the cell membrane.

A: Cell membrane It is defined as the membrane that protects the cell from its environment by…

Q: Identify adaptations that have contributed to pathogen success.

A: Introduction :- Plant and animal diseases can be infectious or non-infectious. We'll concentrate on…

Q: Discuss the societal impacts of the use of transgenic Golden Rice. What are some potential benefits…

A: INTRODUCTION A genetically modified organism is a living organism whose DNA has been altered via the…

Q: You are supplied with the following information about a DNA molecule:  The molecular weight of a…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: loss of function mutation

A: Sorry for the inconvenience. As per bartleby  guidelines we should not give the answers for 2…

Q: If the relative fitness of the A,A, genotype is 0.8, A,Ayis 1.0 and AA is 0.6, what is the mean…

A: Introduction In the absence of other evolutionary factors, the Hardy–Weinberg principle, also known…

Q: Which of the following enables ions such as sodium to cross a plasma membrane? A. phospholipid…

A: Plasma membrane  It is a semipermeable membrane made up of proteins, phospholipids, carbohydrates…

Q: Question 27 To make RNA the nucleic acid sequences get read in the directi -- Sense → Antisense O…

A: Nitrogen-containing bases, phosphate groups, and sugar molecules make up nucleic acids. Each nucleic…

Q: We have the following DNA sequence that codes for 7 amino acids of exon 1 of the dopamine receptor…

A: Here the DNA sequence is - 5' GTG CAC CTG ACT CCT GAG AAG 3' It codes 7 aminoacids.  The…

Q: GUIDE QUESTIONS: 1. Identify the fixation and embedding protocols of seed tissues for microtome…

A: Microscopes are extremely significant equipment that is mostly utilized in the field of science. The…

Q: Primase has the important role of removing the RNA primers and filling the gaps with new DNA…

A: DNA replication There are number of processes necessary for the continuation of generation, growth…

Q: Where is the TATA box found? O It is found in the termination sequence after the gene. O It is found…

A: TATA box is a sequence of TATAAT of six nucleotides. It is found in eukaryotes.

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Marine Evolution

Marine habitat is less explored, and hence, its biological diversity is far less known. The marine habitats are not constant due to their shifting nature, while the terrestrial habitats are more stable. Marine biology is the science that deals with the study of diverse marine species, their interactions, and behavioral characteristics.