Q: Based on his phenotype muggle, with the information provided, can we tell what Dudleys second allele…
A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or…
Q: Describe the different anthropogenic causes of the water cycle.
A: The water cycle, also known as the hydrological cycle or the water balance, refers to the continuous…
Q: Why are the B vitamins especially important to an athlete? A. The B vitamins are directly involved…
A: Vitamin B Vitamins are essential organic micronutrients required by the body for proper growth and…
Q: With respect to the Multiple Sequence Alignment software tool, ClustalW, briefly give an overview of…
A: NOTE: Since you have posted multiple questions so we will be solving the first one for you. As per…
Q: uestion 6 hich conditions would NOT lead to good preservation of a dead hominin skeleton? Dying in a…
A: Erect posture, bipedal mobility, larger brains, and behavioural features like as specialised…
Q: Refer to Figure 18. Are the storage roots of sweet potato ( Ipomoea batatas) and the tubers of…
A: HOMOLOGOUS ORGANS The study of morphological characteristics like origin, development, and position…
Q: metamorphosis of insect
A: The transformation of an immature insect from a larva to a pupa to an adult through out their life…
Q: The cells that are found in tendons are called: A. osteocytes B. adipocytes C. haemocytoblasts D.…
A: tendons connect muscle to the bones. It is a fibrous connective tissue.
Q: Label the pericarp and receptacle of this cucumber plant.
A: Pericarp It is mostly present in the fleshy fruits. It is also known as wall of ovary and it is…
Q: Carb loading is effective on improving an athelete's performance in 100m sprint race? A. True B.…
A: A carbohydrate-loading diet, also known as a carb-loading diet, is a method for enhancing the amount…
Q: Q1. Science can be conducted using experiments or by observation. In both cases, one can deduce…
A: Observation is a vital piece of science. It allows us to see the aftereffects of an experiment,…
Q: What is the source of energy for protein translocation into the ER? Choose one: 1. the action of…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Explain the Organization of the Thylakoid Membrane ?
A: The photosynthesis process takes place within the chloroplast of plant cells. Chloroplasts are well…
Q: Look for recent (2017 to 2022) scientific papers, stories, or features that demonstrate the use of…
A: Introduction Spectroscopy is a broad field of study that examines and interprets the electromagnetic…
Q: Why might the GluR-B mutation prevent calcium from moving through the receptor?
A: The physical and functional unit of that generally states that term which define the heredity is the…
Q: Are other life chemistries possiblebesides the single one known on Earth(and described in this…
A: Carbon is referred to as an important backbone of every biological molecule that is known today.…
Q: The pinna:
A: The question is based on sense organ ear.
Q: the angle formed by the rest and :the minor connector should be less than 90° .More than 90° less…
A: A minor connector is the connection among an RPD's primary connector or base and the prosthesis'…
Q: Why is flexibility the most neglected component of health-related fitness?
A: The bulk of citizens, even those who place a high priority on other aspects of fitness, prefer to…
Q: How was the first natural antibiotic discovered? (To answer this question, identify the antibiotic,…
A: Antibiotics are antimicrobial substances that are active against microorganisms. It is the most…
Q: Cocaine is a drug that acts by blocking dopamine transporters, the proteins responsible for the…
A: Cocaine is a drug that is highly addictive, it increases alertness, attention, and energy. It is an…
Q: 10 0.9 0.8 8- 0.7 0.6 0.5- 0.4 5- 4- 3 2 0.3 0.2 0.1 01 234 S 6 7 8 9 10 Size of individual…
A: Answer :: The correct answer would be 0.7 From the graph it is deductable that ,As the if the…
Q: Invasion step of metastasis is a complex process that involves epithelial cells transitioning into…
A: Epithelial cells are specialised cells that coat the insides of spaces, organs, and blood vessels.…
Q: Assess the following situations: a. A field planted with rice in their early vegetative stage…
A: Reproductive phase is the phase of the plant where the grains or seeds are produced after…
Q: Distinguish between “fundamentalcauses” and “proximate risk factors” ascauses of disease.
A: Fundamental factors:- Fundamental factors are the factors which can be attributed as the main…
Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…
A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…
Q: Dye name Lane/well number ... Distance traveled ... To which pole (+/-) ... ... 1 BB-Bromophenol…
A: In biology, dye is a chemical colouring material, consisting of chromophore and auxochrome groups…
Q: A student was asked to list the organelles that would be abundant in a cell that synthesizes…
A: The Organelles are little structures that are present inside the cytoplasm that complete funtions…
Q: How many copies of each type of core histone would it take to wrap the entire human genome into…
A: Introduction -The haploid human genome is made up of roughly 3 billion base pairs of DNA organised…
Q: 2. Glucose and amino acids are absorbed in the by and A. stomach; facilitated diffusion; endocytosis…
A: Absorption in small intestine Absorption of Carbohydrates: Monosaccharide are absorbed via the…
Q: Tiktaalik and Protarchaeopteryx are examples of transitional forms. In paleontology, what does…
A: Paleontology, usually spelled palaeontology or palaeontology, is the scientific study of life…
Q: The FITT principle is? A. The principle that a good physical fitness program should be based on…
A: Exercise is a significant aspect of determining an individual's health. Lack of physical activity…
Q: Discuss what effective population size (Ne) is , and why is it of importance for conservation…
A: The effective populace size is the size of an optimal populace that would lose heterozygosity at a…
Q: ➢ Is the tripartite body plan of phoronids advantageous for them? Why or why not? ➢ Why is the…
A: Phoronids Phoronids are also known as horseworms. These are small marine organisms of the animal…
Q: You are tasked to isolate a certain species of bacteria from a mixed culture to further characterize…
A: Bacteria are small single-celled organisms. Bacteria are found almost everywhere on Earth and are…
Q: Order the following structures of the kidney in the sequence in which fluid passes through them on…
A: The kidneys are two reddish bean-shaped organs on either side of the spine, lying below the rib…
Q: New genetic variations may occur because of (Check all that apply) Select 3 correct answer(s)" A)…
A:
Q: Which of the following statements concerning photoreceptors is not correct cones produce colored…
A: Introduction The retina is a light-sensitive layer of tissue at the rear of your eye that delivers…
Q: Narrow spectrum Penicillin act on
A: Penicillins is a group of antibiotics which is mainly obtained from penicillium moulds like…
Q: Compare and contrast insects with arachnids and myriapods.
A: Invertebrates with an exoskeleton, segmented bodies, and coupled hinged legs are known as…
Q: Which of the following is a 'club moss' ? (A) Selaginella (B) Equisetum (C) Lycopodium (D) None of…
A: Introduction - Club mosses have needlelike or scalelike leaves and are low evergreen herbs. Many…
Q: How many clades are represented in Figure 20?
A: Clade A clade is a graphic representation of group of organisms that includes it's ancestor as well…
Q: Explain whether Person O finds the carved initials higher relative to ground level after ten years.
A: Introduction Plant growth is described as the increase in volume and/or mass of a plant, with or…
Q: After about three seconds to start an intense excercise, which substance is immediately broken down…
A: D. Creatine phosphate
Q: What is Medical Terminology, why is it beneficial to know , what is it used for …. How can it be…
A: Introduction :- Medical terminology is a vocabulary that is used to precisely describe the human…
Q: After intense excerise, an athelte needs to have a high-carbohyrdrates meal within 24 hours? A.…
A: The daily diet and nutrition of an athelete is different as they workout more than normal person.
Q: Amplified target regions of four different samples were separated using gel electrophoresis. DNA…
A: Gel electrophoresis is a lab technique for separating DNA, RNA, and protein mixture based on their…
Q: How much more Rohydraloxide does it take for the rats to have a 50% probability of death if the rat…
A:
Q: Development of insects are affected by many factors. Cite three major influencers and state how they…
A: Insects are the class of organisms that belong to the Phylum Arthropoda. Like any other Arthropod…
Q: Name three characteristics that set vertebrates apart from other animals
A: The phylum of vertebrates, which includes Aves, reptiles, amphibians, and mammals, is defined by the…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Sickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 PBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below: Gene F 5' ATGGGAGCACCAGGACAAGATGGATATCATTAG 3' 3' AGTTACCCTC GT GG TCCTGTTCTACCTATAGTAS Gene G Questions: 1. Write down the messenger RNA sequence when Gene F is transcribed. 2. Write down the polypeptide chain when Gene F is completely expressed. 3. Write down the messenger RNA sequence when Gene G is transcribed. 4. Write down the polypeptide chain when Gene G is completely expressed.Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'. 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a T, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutation 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G in Bold changes to a A, then the result will be A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutationGiven Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:
- EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA Translated amino acids Asp Thr Phe Val Asn EboV Strain 1 EboV Strain 1 (Circle the mutated bases) CCA TGT AAG TGG TTA mRNA Protein Of the mutations you identified, how many are: _______substitutions __________ frameshifts The result of the caused by the mutation is (silent, missense, nonsense). Underline your answer.Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2