Specify the absolute configuration (R or S) for:  Prozac, Paxil.

Q: Agarose gel electrophoresis is relatively simple and straight forward to perform. Agarose is a…

A: two monomer units present in agarose are:

Q: polystysene (styrofoam cue) PerkinElmer Spectrum IR Version 10 6.0 Tuesday March 22, 2022 6:52 PM…

A: IR Spectroscopy tells us about the functional  group present  in the molecules.

Q: What is the Delta G for the reaction N2O4>2NO (kc= 0.144 at 298K and R=8.314) A)-4.80 Kj/mol B)…

A:

Q: Amino acids can be synthesized by reductive amination. Draw the structure of the organic compound…

A: In a reductive amination reaction, carbonyl compound reacts with ammonia or amine to form an imine…

Q: 16. The expression of Ksp for Ni(OH)2 is: |N²+] • [OH¯]² [Ni*]* · [OH¯] DNi*] · [OH¯ None of the…

A: The solubility product constant Ksp is the equilibrium constant for a solid substance dissolving in…

Q: Below is the structure of a hypothetical photo-affinity probe analogue of the anti- malarial drug…

A: Cross-links with nearby proteins in the presence of UV light. B is the correct answer.

Q: Two weak acids, HA and HB, have K4 values of 1.0 E-6 and 3.0 E-4. Their partition coefficients…

A: Given :-HA⇌H++A- Ka=1x10-6  KHA=12.2HB⇌H++B-Ka=3x10-4 KHB=8.3Ka=H+A-HA=A-HA=KaH+Distribution ratio…

Q: Give out chemical reactions of butadiene complexs Please answer breifly ASAP

A:

Q: 1. Write the expression for Ksp for a. Ag2CrO4     b. Ca3(PO4)2

A:

Q: نقطتان )2( Which statement is correct Ksp of AgCl is equal that of Ag2Cr04 Ksp of AgCl is more than…

A: The Ksp of AgCl is 1.8 x 10-10 The Ksp of Ag2CrO4 is 1.1 × 10 -12

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Calculate for the solubility of PbF2, given the value of its Ksp. Ksp of PbF2 = 3.3 x 10-8

A:

Q: What is the correct order for the strenth of IMFA of the following substances?     LiCl < H2O <…

A: The attraction forces between the two molecules are known as intramolecular forces of attraction.…

Q: What is the essential difference between the Langmuir and BET isotherms?

A: The adsorption of the gases and the solute is basically explained through isotherms. The adsorbate…

Q: S. cerevisiae on ethanol is simply described by the folowing reaction CHOH + aO, DNH3 f CH, sANa1000…

A:

Q: The Hill coefficient (nH) for myoglobin is _; whereas for hemoglobin ny is about O 2.8; 5.0 O 1.0;…

A:

Q: IUPAC and the omega-nomenclature of LCDs

A: Answer -  Omega-nomenclature - The Omega Nomenclature is almost exactly the same as the Delta…

Q: calculate the Keq of a reaction that has a DeltaG of 8.8 kJ/mol at 25C.

A: Given delta G = 8.8kj/mole  1kj = 1000 joules 8.8 kj = 8.8 × 1000= 8800 joules  Formula used  Delta…

Q: If a particular 150 amino acid polypeptide is known to sample 4 preferred states as it folds into…

A:

Q: Show that (35), - (25) = ( ) - ( ), ан ар aG ар

A:

Q: Given that Ksp for BaCO3 = 1.6 x 10-9, Ksp for CaCO3 = 4.7 x 109, Ksp for MGCO3 = 1.0 x 10 15, Ksp…

A: Note:  As the question consists of multiple questions from different concepts, we are saving the…

Q: Find the isoelectric and zwitter ion of lysine

A: isoelectric point means the characteristic pH at which net effective charge of an amino acid is…

Q: Please give me explanation (1 to 2 pages) about: What is PVDF membrane? What are the advantages of…

A: PVDF membrane : Poly(vinylidene fluoride) (PVDF) is the popular membrane materials due to its…

Q: The Ksp for BaF2 is 1.6x10^-6.What is tge concentration of Ba+2 ions in this solution?

A: The balanced equation for the dissociation of BaF2 is, BaF2 s ↔ Ba2+aq  + 2F-  aq…

Q: nsider a ternary (three-component) system of amphiphile, hydrocarbon, and water. What structure do…

A:

Q: A boiler burns fuel oil with 15% excess air. The fuel oil may be presented by C₁₄ H₃₀. Calculate the…

A:

Q: Dotougite the Cnplex frans((oil2 (usl3)) qnd Complex trans-twifrntB) THust vatet 0Ptilalisamers…

A: coordination compounds are generally tetrahedral, spqare planar and octahedral. bonding direction of…

Q: H2C H2C CH2 Н—с-он н—с-о, 2 H2C B(OH)4 H2C CH2 + + 4 H Н—с—он H FC-o о—с—н H2C H2C CH2 PVA temporary…

A: Applying concept of nucleophilic substitution reaction on boron center.

Q: Calculate the index of hydrogen deficiency of this compound  Q.) Urea, CH4N2O

A: The rings and multiple bonds reduces the hydrogen count by two and it is known as index of hydrogen…

Q: Describe Brownian motion in continuum transport. I want a clear solution for me to understand

A:

Q: What kind of differences are there in crystallizing in unit cell with 1. Chiral (enantiomerically…

A: A chiral compound is distinguished from its mirror images as these are non-superimposable. A chiral…

Q: Since the Coomassie Brilliant Blue G-250 is a highly (basic, acidic) dye, it cannot be used for…

A: The structure of Coomassie brilliant blue G-250 is:

Q: Does BrCH2CH2Br have 1 unique hydrogen environment.  True or False?

A: Hydrogen NMR spectroscopy is used for the determination of the structure of the molecule. The…

Q: What is observed with the Ksp of of AgCl and Ag2Co3 at two different temperatures?

A: Ksp is the solubility product as it is the product of the solubilities of the ions in moles per…

Q: Why does the mobile phase in reversed phase (C18) HPLC needs to be acidic?

A:

Q: 2. How will the melting point of your semicarbazone derivative be af- fected if the derivative is…

A:

Q: Detailed explanation of what is a biphasic system. With diagrams and also its use in everyday life…

A: Biphasic systems (BSs) are formed when two immiscible phases, (ionic - liquid based aqueous) soluble…

Q: Mescaline (see structure X) is a naturally-occuring psychedelic compound isolated from the peyote…

A: In organic laboratories, acid-base extraction involves the extraction of an organic compound using…

Q: Match column A with column B. Write the CAPITAL letter on the space provided before each number.…

A: We have to Match column A with column B and  Write the CAPITAL letter on the space provided before…

Q: The osmotic pressure of a protein solution was measured at 25°C. The following data were obtained. c…

A:

Q: Unknown #: 4 s,9H d, 3H 9, 1H s,1H 11 10 8 ppm 180 160 120 100 80 20 200 140 60 40 ppm nasicITIKEIU

A:

Q: 0ompue to follawing acıd-base nautralizaton freaction.unatis the sum of tHhe coefficients For the…

A: Solution- above given complete reaction- H2SO4 + KOH  - - - &gt; K2SO4 + H2O

Q: What is the Kb expression for CN-?

A:

Q: Asparagine and glutamine residues in proteins are deamidated in an aqueous solution to yield…

A: Deamidation is the conversion of amide group to another functional group. Side chain of amino acid…

Q: Calculate the index of hydrogen deficiency of this compound  Q.) Cholesterol, C27H46O

A: The measure of IHD is an index of hydrogen deficiency of a compound. It is also called the unite of…

Q: The K2S208 product may be contaminated with K2SO4 or KHSO4. Suggest a method for determining the…

A: PREPARATION OF K2S2O8: The preparation reaction of potassium peroxydisulfate is takes place with the…

Q: Is it possible to prepare a 17% dye solution from a 4% stock dye solution? Explain your answer.

A: Given : Stock solution with concentration = 4 % (Assuming by mass) And concentration of solution to…

Q: Próblém Suppose that thermal stability experiments have given the following (partial) thermodynamic…

A: ∆G=∆H-T∆S 5.33 *10^3 = 150*10^3 -(45+273)(∆S) (45+273)(∆S) = (150-5.33) *10^3 (∆S)= (144.67*10^3)/…

Q: Is it possible to prepare a 17% dye solution from a 4% dye solution? Explain.

A: If the solution is too weak in terms of concentration, we can evaporate some of the solvent to make…