Spaced practice question: Consider a membrane protein and its chemistry. Which of the following would describe a channel protein? It is an inorganic compound. It is an example of a globular (functional) protein. It is stable when exposed to an acidic environment. It is an example of a fibrous (structural) protein.

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a…

A: Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Which of the following channel types does not need 5 subunits to make a functional channel pore? a.…

A: The nervous system is one of the organ systems in the human body. It is involved in coordinating the…

Q: LEARNING OBJECTIVE ENE-2.A Describe the roles of each of the components of the cell membrane in…

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: [Membrane Proteins] Based on the figure provided, What classification best describes G-proteins?…

A: G proteins, generally defined as guanine nucleotide-binding proteins, are a protein family that acts…

Q: Actin filaments, microtubules, and bacterial flagella are all built from small subunits. Describe…

A: Introduction: Actin monomers meet up to frame actin filaments. It is also known as F-actin and has a…

Q: State if the following is True or False: 1. The occurrence of ionic interactions between water…

A: Water is also a chemical compound that is composed of one atom of oxygen and two atoms of hydrogen.…

Q: Give a brief description of what the term ‘native protein’ state refers to. Your answer should make…

A: Introduction: Proteins are biological polymers made up of amino acids connected covalently by…

Q: Explain the experimental procedure used byLoewenstein to determine the size of molecules that can…

A: In a multicellular organism, cells are linked to each other by specialized structures called cell…

Q: Please asap. thanku Which channel types does not need 5 subunits to make a functional channel pore?

A: Ion Channels --- Ion channels play important role in regulating cellular excitation. These are…

Q: 3. Using mathmatical calculations, show why 0.9% NaCl solutions and 5% dextrose (glucose) solutions…

A: Hypotonic Solution: A fluid that differs from regular blood and cells in that it contains fewer…

Q: Hydropathy plot analysis of your protein of interest reveals a single, prominent hydrophobic peak.…

A: The hydropathy plot, in the case of proteins, gives the idea about the hydrophilic and hydrophobic…

Q: What is LPS (not just what does it stand for)

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: xplain how can one predict the number of transmembrane domains (TM helices) in an integral membrane…

A: Membrane proteins are in charge of most of the dynamic processes carried out by membranes. Most…

Q: Please describe the hydrophobic effect and its contribution to membrane protein folding

A: The hydrophobic effect being the major driving force for the membrane protein folding

Q: The model of an ion channel is composed of five polypeptide subunits. What are they?

A: The ion channel play an important role in the transmission of electrical signals along the membrane…

Q: Focal adhesion complex attachment to extracellular matrix molecules is mediated by:   heterodimers…

A: Focal adhesions are complex plasma membrane-associated macromolecular assemblies that engage with…

Q: The following hydropathy plot was obtained for an unknown membrane protein. 20 40 60 00 Residue…

A: Membrane proteins are responsible for most of the dynamic processes carried out by membranes. Most…

Q: Which feature of protein folding is NOT accurate?

A: Proteins perform a variety functions within organisms, including catalysing DNA…

Q: Q-Slide #6 Add icons to show what CaMKII does to its substrate proteins Me СР2 Ca" CP2 Me Glu СВР…

A: CaM kinases are family of enzymes enriched in nervous tissue that are activated by binding to…

Q: Membrane channels and carriers both show changes in protein conformation.  What is the role of such…

A: Introduction:- Cell membranes are selectively permeable, allowing only certain chemicals to pass…

Q: 2. Roughly sketch the hydropathy plot for the given hypothetical membrane protein. Follow the color…

A: A hydropathy profile helps to identify the topogenic sequences of proteins. The peaks of a…

Q: Regarding how information is passed through the cell, why is the state (confirmation) of a cell…

A: The cell membrane is a supporter of cells that's one of the great multi-taskers of biology. It…

Q: Cleavage Ligand Precursor Receptor Inactive Receptor Active www 99 Cell Membrane 6. The figure above…

A: In case of hydrophilic signalling molecules (ligand), they binds with specific transmembrane…

Q: 4. In an experiment to determine the water potential of fresh beetroot tissue, a student cut 12…

A: A. Beet root contains a special pigment betalains in their stem tubers. This pigment help to know…

Q: SIGNALS AND TARGETS. Listed below are sample polypeptides/proteins with their signal…

A: Introduction  A polypeptide is an unbranched, continuous chain of amino acids held together by…

Q: Contraction of both skeletal and smooth muscle requires the influx of Ca2+ into the cytoplasm.…

A: Soft and contractile tissues that are mainly responsible for body movement are called Muscles.…

Q: The sarcoplasmic reticulum Ca2+-ATPase, pumps 2 mol Ca2+ out of sarcomeres per mol ATP hydrolyzed.…

A: The formula to calculate ΔG is given by the below formula, where ΔG is the free energy change, R is…

Q: 6. You discover a new transmembrane ion channel and upon structural characterization you demonstrate…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: Roughly sketch the hydropathy plot for the given hypothetical membrane protein. Follow the color…

A: Hydrophobic (water-hating) or hydrophilic (water-loving) molecules exist (water-loving). A…

Q: Q5. Ion exchange chromatography purifies a protein based on difference in magnitude of net Identify…

A: Chromatography is the separation of a mixture of compounds into their individual components based on…

Q: Based on the F-actin assembly data presented above, which type of actin-binding protein is Protein…

A: F- actin is a crucial protein for cellular  function and responsible for cell stability. Actin…

Q: |26 Which protein is NOT attached to the vesicle? O a. Synaptobrevin O b. SNARES VAMP O d. Syntaxin…

A: Vesicle is a substance that contains gases or fluids and is enclosed with a lipidbilayer. It helps…

Q: The 3-D structures of membrane proteins can be determined using SDS-PAGE.

A: Gel electrophoresis is the widely used technique in molecular biology for the separation of the…

Q: The tight binding sites required for ion selectivity should slow the progress of ions through a…

A: Membrane permeability refers to the passage of the ions from the exterior region to the interior…

Q: Why can’t Myosin V motor proteins “walk” towards the negative end of the actin molecule? Why do most…

A: Sarcomere is the contractile unit in muscles. The figure below shows a Sarcomere The blue color…

Q: Create a ROUGH SKETCH (no need for exact hydropathy indices and residue numbers) of the hydropathy…

A: A hydropathy plot is an analytical tool that lets us quantitatively determine the hydrophobic or…

Q: Describe what gap junction are, emphasizing on how they are different two other cellular points of…

A: Cells are the basic structural and functional units of life. Cells form tissues. Tissues organize…

Q: Roughly sketch the hydropathy plot for the given hypothetical membrane protein. Follow the color…

A: Proteins are composed of a linear chain of amino acid sequences attached via peptide bonds. Natural…

Q: Exercise 1 Summarize the data below obtained from the protein experiments for determination of…

A: The Bradford assay is based on the observation that the absorbance maximum for an acidic solution…

Q: Differentiate the action in extracting integral and peripheral protein from cell membra

A: Peripheral proteins form temporary bonds with the cell membrane, allowing them, with specific…

Q: Isotonicity. Show your complete solution. 1. A hospital pharmacist fills a medication order calling…

A: As per our policy, we are answering the first 3 questions only. Kindly repost for other questions.…

Q: CONSTRUCTIVE RESPONSE. Answer the following questions.  What are the requirements for molecules to…

A: Hydrogen bond is formed when hydrogen is covalently bonded to a very electronegative atom such as…

Q: Exercise B: Peptide Bond Formation Figure 2 shows two individual amino acids, and then those same…

A: Macromolecules are types of biomolecules that are needed in large amounts for the growth and…

Q: 2. Roughly sketch the hydropathy plot for the given hypothetical membrane protein. Follow the color…

A: The amino acids can be classified based on the polarity of the side chains to form a scale called…

Q: Need help  Ligaments and tendons are tissues whose response varies with time and exhibits rate…

A: Hi dear, here's your answer.   Tendons and ligaments show both non straight and viscoelastic conduct…

Q: Discuss the 2 motor proteins associated with the MT in detail, but do not include structure.

A: Microtubules is a type of cytoskeletal protein that has specific role within the cell. Several…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.