Regarding the analysis of single marker STR results used in forensic science. Tick all the correct statements: O if a suspect's alleles are different from those collected at a crime scene, then the suspect is possibly innocent if a suspect's alleles are identical to those collected at a crime scene, then the suspect is possibly guilty O O two unrelated individuals could have a similar genetic profile monozygotic twins may have different alleles at an STR locus O if a suspect's alleles are identical to those collected at a crime scene, then the suspect is definitely guilty O no correct statement oo O oo if a suspect's alleles are different from those found at a crime scene, then the suspect is definitely innocent O dizygotic twins can have similar alleles at an STR locus O oo O monozygotic twins cannot have different alleles at an STR locus O dizygotic twins cannot have similar alleles at an STR locus
Q: 2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A…
A: Focus only on EcoR1. Than focus on EcoR1 and HindIII. Than focus on EcoR1, HindIII and Pst1
Q: The 02 to be utilized by the mitochondria of all eukaryote cells is produced by A) Oxidative…
A: Mitochondria is the cell organelles, found in most of eukaryotes. Mitochondria perform aerobic…
Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…
A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…
Q: Which of the following statements concerning p53 is NOT correct? O a. O b. O C. p53-dependent…
A: p53 is a gene that helps to control the cell cycle and prevent cells from becoming cancerous. It…
Q: 44. Experiments have shown increasing fertilization tends to reduce the numb resources for plant…
A: Any element in the environment that has the potential to restrict a process, such as the expansion,…
Q: The sheep liver fluke is an organism that lives in the intestines, liver, brain, and lungs of sheep…
A: In case of multiple questions, first question is solved as per our company policy. If you want help…
Q: 4.08 H H ↓ 1.02 ↓ | 2.54 11.02↑ E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H…
A: Endonuclease HindIII is a type II restriction enzyme that recognizes and cleaves the palindromic…
Q: Is Enzyme a monomer or polymer?
A: Question : Is Enzyme a monomer or polymer ? Answer : Enzyme is a polymer of amino acids.…
Q: The amount of sodium in Bowman's capsule is determined by: A. Intracellular [Na] OB. Extracellular…
A: At the level of Bowman's capsule, amount of sodium will be only determined by the extracellular…
Q: Which is not a characteristic of mitochondria? They .. A) Have 2 membranes B) Are the site of…
A: Cells produce energy molecules at the sites of mitochondria, which are membrane-bound organelles. It…
Q: The human body has structures that could be considered the product of “unintelligent design” (i.e.…
A: Organisms are never perfectly designed or adapted. In reality, "perfection" cannot be found in…
Q: A patient that received a knee replacement implant is experiencing high fever, inflammation, and…
A: Inflammation is the body's response to injury, irritation or infection. It involves the release of…
Q: In eukaryotes, Cot DNA reassociation curves are not smooth. They have bumps. Why? What are the…
A: Genome of an organism can be defined as a sum total of all the genetic material present in it.Genome…
Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.
A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…
Q: There are several factors that contribute to high fidelity of DNA replication. Which of the…
A: To preserve genetic integrity and to ensure genetic continuity, DNA that is transferred to daughter…
Q: Describe agglutination reaction test used to determine A, B , AB or O blood types. Must explain each…
A: A blood group is classified on the basis of antigens present on the surface of the RBCs. These are…
Q: which of the following is NOT a possible source of the monomer building blocks in the RNA world…
A: RNA world hypothesis assumes the formation of early living beings which uses RNA as genetic…
Q: Use arrows to identify the transition of the type of epithelium, esophageal glands and gastic glands…
A: The stomach is a J-shaped organ in human body that helps in digesting food. It produces enzymes and…
Q: State and recognize the three basic nutritional needs an organism’s diet must satisfy. List the…
A: Food consists of nutrients. Nutrients is categorised into seven major groups carbohydrates,…
Q: Dichotomous Key Homework Use this Dichotomous Key and identify each of these seven leaves. You can…
A: Using the dichotomous key for the given leaves Following things can be concluded: (1):- It is a…
Q: can you please label on the image i have provided
A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…
Q: 2. The TP53 gene normally functions as a tumor suppressor by preventing abnormal cell growth but is…
A: In this question it is clearly mentioned about a specific gene TP53 and uncontrolled cell growth due…
Q: 4. Explain the mechanisms of SYBR green and TaqMan in real-time PCR. 5. Explain what Ct mean and…
A: SYBR Green is a cyanine dye which is used to stain the nucleic acid. This dye is most commonly used…
Q: Question 16 What is a common misconception about diabetes? O You can lose a limb Diabetes stems from…
A: Diabetes mellitus is a disorder of carbohydrate metabolism characterised by impaired production or…
Q: Describe the difference between the terms INFECTION and DISEASE. Starting with exposure to…
A: Pathogens are essentially any germ or organism that lives in the bloodstream of an infected person…
Q: which of the following is used to help make sure a metagenomic study has fully measured the…
A: Metagenomics is noteworthy since it may be utilized to examine assorted microorganisms found in…
Q: How does sexual selection differ from natural selection? a. It does not require heritable traits. b.…
A: Natural selection typically results in people who are well-adapted to their environment, whereas…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: The simple act of covering the nose and mouth with a tissue when coughing or sneezing is an…
A: Introduction: Our reflexive ability to cough serves to shield our lungs and airways from irritants.…
Q: If you are interested in seeing how proteins are folded, you might choose a the proteins wireframe…
A: The amino acid sequence of proteins controls the stable 3-D conformations that they take on.…
Q: The police present you with 4 unsolved missing persons cases from the area where the remains were…
A: In the question it is given to find out that which of the following is a hiker and most likely to be…
Q: Using biotechnology, including PCR it is possible test many people for COVID-19 rapidly and…
A: PCR allows accurate diagnoisis of COVID-19 with theoritical sensitivity and specificity approaching…
Q: Lophotrochozoans add to their skeletal elements in abrupt rapid gradual invasive increments.
A: Introduction:- Animals are classified into different groups on the basis of various features and…
Q: explain the importance of uniqueness in genetics.
A: Because DNA is a form of hereditary material, every person has a unique genetic structure. A…
Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…
A: The emergence of SARS-CoV-2, which generates the COVID-19 sickness, has caused a significant global…
Q: n fossil record, we would expect to find species with a nomocercal tail before (i.e., earlier than)…
A: The diagram is representation of phylogenetic tree which represents various groups. This…
Q: Define what is meant by the term Group A Strep (GAS). What are three properties that you could…
A: Group A strep is also called as group A streptococcus. These are the bacteria which can be found in…
Q: If the clearance of sodium doubles in a normal person then the following is physiologically likely:…
A: If the clearance of sodium doubles in a normal person: Doubling of plasma sodium will not occur…
Q: Based on the haplotype network below, which statement is correct? a. None of the answers is correct…
A: A sort of genetic difference within humans can be called single nucleotide polymorphisms or SNPs.…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: In a kidney transplant, a healthy kidney from a living or deceased donor is surgically implanted…
Q: Bacterial DNA Process 1 Process 2 C. Human DNA a. Process 1: Restriction enzyme Process 2: Ligase…
A: Recombinant DNA technology is a method by which jeans are combined from two different sources in…
Q: 1. Who are at risk of having TB infection? (Tick the appropriate box) Risk group: HIV infected…
A: Some infectious pathogens can present in the air for longer periods of time. These microorganisms…
Q: Synthesis of new bacteriophages in a bacterial host involves the use of a.) Host cell encoded…
A: Phages that only infect bacteria are known as bacteriophages. Phage are available in a wide range of…
Q: Lod score:
A: An LOD score is a statistical estimate of the relative probability that two loci are located near…
Q: Are cells grown in the laboratory will function similarly when transplanted?
A: Transplanting laboratory-grown cells into the body causes them to behave similarly. For instance,…
Q: frequencies for a single gene with two alleles for three different populations.…
A: According to Hardy Weinberg equilibrium equation- p2 + q2 + 2pq =1 and p + q =1 Where, p =…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: Introduction: Uterus Also called womb is an important organ of female reproductive system.its main…
Q: Describe the process of RNA interference (RNAI). Include the proteins involved, how the process…
A: RNA interference is an evolutionarily conserved process activated by double-stranded RNA that turns…
Q: What is epidemiology? there are several ways pathogens can be transmitted including direct contact,…
A: Pathogen can be defined as an organism or agent which is able to cause disease in the…
Q: you something like this photo taken from the internet…
A: Plants belong to the kingdom plantae.plants aee able to perform photosynthesis process,because of…
Step by step
Solved in 3 steps
- Pedigree Analysis Is a Basic Method in Human Genetic: What does OMIM stand for? What kinds of information are in this database?Pedigree analysis is a fundamental tool for investigating whether or not a trait is following a Mendelian pattern of inheritance. It can also be used to help identify individuals within a family who may be at risk for the trait. Adam and Sarah, a young couple of Eastern European Jewish ancestry, went to a genetic counselor because they were planning a family and wanted to know what their chances were for having a child with a genetic condition. The genetic counselor took a detailed family history from both of them and discovered several traits in their respective families. Sarahs maternal family history is suggestive of an autosomal dominant pattern of cancer predisposition to breast and ovarian cancer because of the young ages at which her mother and grandmother were diagnosed with their cancers. If a mutant allele that predisposed to breast and ovarian cancer was inherited in Sarahs family, she, her sister, and any of her own future children could be at risk for inheriting this mutation. The counselor told her that genetic testing is available that may help determine if this mutant allele is present in her family members. Adams paternal family history has a very strong pattern of early onset heart disease. An autosomal dominant condition known as familial hypercholesterolemia may be responsible for the large number of deaths from heart disease. As with hereditary breast and ovarian cancer, genetic testing is available to see if Adam carries the mutant allele. Testing will give the couple more information about the chances that their children could inherit this mutation. Adam had a first cousin who died from Tay-Sachs disease (TSD), a fatal autosomal recessive condition most commonly found in people of Eastern European Jewish descent. Because TSD is a recessively inherited disorder, both of his cousins parents must have been heterozygous carriers of the mutant allele. If that is the case, Adams father could be a carrier as well. If Adams father carries the mutant TSD allele, it is possible that Adam inherited this mutation. Because Sarah is also of Eastern European Jewish ancestry, she could also be a carrier of the gene, even though no one in her family has been affected with TSD. If Adam and Sarah are both carriers, each of their children would have a 25% chance of being afflicted with TSD. A simple blood test performed on both Sarah and Adam could determine whether they are carriers of this mutation. Would you decide to have a child if the test results said that you carry the mutation for breast and ovarian cancer? The heart disease mutation? The TSD mutation? The heart disease and the mutant alleles?Pedigree analysis is a fundamental tool for investigating whether or not a trait is following a Mendelian pattern of inheritance. It can also be used to help identify individuals within a family who may be at risk for the trait. Adam and Sarah, a young couple of Eastern European Jewish ancestry, went to a genetic counselor because they were planning a family and wanted to know what their chances were for having a child with a genetic condition. The genetic counselor took a detailed family history from both of them and discovered several traits in their respective families. Sarahs maternal family history is suggestive of an autosomal dominant pattern of cancer predisposition to breast and ovarian cancer because of the young ages at which her mother and grandmother were diagnosed with their cancers. If a mutant allele that predisposed to breast and ovarian cancer was inherited in Sarahs family, she, her sister, and any of her own future children could be at risk for inheriting this mutation. The counselor told her that genetic testing is available that may help determine if this mutant allele is present in her family members. Adams paternal family history has a very strong pattern of early onset heart disease. An autosomal dominant condition known as familial hypercholesterolemia may be responsible for the large number of deaths from heart disease. As with hereditary breast and ovarian cancer, genetic testing is available to see if Adam carries the mutant allele. Testing will give the couple more information about the chances that their children could inherit this mutation. Adam had a first cousin who died from Tay-Sachs disease (TSD), a fatal autosomal recessive condition most commonly found in people of Eastern European Jewish descent. Because TSD is a recessively inherited disorder, both of his cousins parents must have been heterozygous carriers of the mutant allele. If that is the case, Adams father could be a carrier as well. If Adams father carries the mutant TSD allele, it is possible that Adam inherited this mutation. Because Sarah is also of Eastern European Jewish ancestry, she could also be a carrier of the gene, even though no one in her family has been affected with TSD. If Adam and Sarah are both carriers, each of their children would have a 25% chance of being afflicted with TSD. A simple blood test performed on both Sarah and Adam could determine whether they are carriers of this mutation. Would you want to know the results of the cancer, heart disease, and TSD tests if you were Sarah and Adam? Is it their responsibility as potential parents to gather this type of information before they decide to have a child?
- Pedigree analysis is a fundamental tool for investigating whether or not a trait is following a Mendelian pattern of inheritance. It can also be used to help identify individuals within a family who may be at risk for the trait. Adam and Sarah, a young couple of Eastern European Jewish ancestry, went to a genetic counselor because they were planning a family and wanted to know what their chances were for having a child with a genetic condition. The genetic counselor took a detailed family history from both of them and discovered several traits in their respective families. Sarahs maternal family history is suggestive of an autosomal dominant pattern of cancer predisposition to breast and ovarian cancer because of the young ages at which her mother and grandmother were diagnosed with their cancers. If a mutant allele that predisposed to breast and ovarian cancer was inherited in Sarahs family, she, her sister, and any of her own future children could be at risk for inheriting this mutation. The counselor told her that genetic testing is available that may help determine if this mutant allele is present in her family members. Adams paternal family history has a very strong pattern of early onset heart disease. An autosomal dominant condition known as familial hypercholesterolemia may be responsible for the large number of deaths from heart disease. As with hereditary breast and ovarian cancer, genetic testing is available to see if Adam carries the mutant allele. Testing will give the couple more information about the chances that their children could inherit this mutation. Adam had a first cousin who died from Tay-Sachs disease (TSD), a fatal autosomal recessive condition most commonly found in people of Eastern European Jewish descent. Because TSD is a recessively inherited disorder, both of his cousins parents must have been heterozygous carriers of the mutant allele. If that is the case, Adams father could be a carrier as well. If Adams father carries the mutant TSD allele, it is possible that Adam inherited this mutation. Because Sarah is also of Eastern European Jewish ancestry, she could also be a carrier of the gene, even though no one in her family has been affected with TSD. If Adam and Sarah are both carriers, each of their children would have a 25% chance of being afflicted with TSD. A simple blood test performed on both Sarah and Adam could determine whether they are carriers of this mutation. If Sarah carries the mutant cancer allele and Adam carries the mutant heart disease allele, what is the chance that they would have a child who is free of both diseases? Are these good odds?Pedigree Analysis Is a Basic Method in Human Genetic: What are the reasons that pedigree charts are used?I'm so confused with these table, how do I find the number for each one. I can do the formula but the rest im confused. Biology II. Please show me how to do it for I can practice. In a class of 20 biology students, 12 have the recessive disorder, chronic whining syndrome. Use the Hardy-Weinberg equations to determine the frequency of the recessive allele for the chronic whining disorder within the class of 20 students.
- Name Addie weal Bikini Bottom Genetics Scientists at Bikini Bottoms have been investigating the genetic makeup of the organisms in this community. Use the information provided and your knowledge of genetics to answer each question. 1. For each genotype below, indicate whether it is a heterozygous (He) OR homozygous (Ho). TT Bb DD Dd ff Tt Which of the genotypes in #1 would be considered purebred? Which of the genotypes in #1 would be hybrids?. Ff bb Yy Square shape is dominant to round. SS Ss yy tt 2. Determine the phenotype for each genotype using the information provided about SpongeBob. Yellow body color is dominant to blue. YY SS BB 3. For each phenotype, give the genotypes that are possible for Patrick. A tall head (T) is dominant to short (t). Tall= Short = Pink body color (P) is dominant to yellow (p). Pink body= Yellow body = dd FF 4. SpongeBob SquarePants recently met SpongeSusie Roundpants at a dance. SpongeBob is heterozygous for his square shape, but SpongeSusie is round.…The world can be a scary place. There are many disease causing organisms and genetic disorders that can make life difficult. As you read the chapter, be thinking about your family history of genetic disorders, how these disorders are passed on through generations, and what types of testing can be done to look for these alleles. In this exercise you will reflect on the pros and cons of genetic testing and how it may affect you. Please remember to add a question to engage your classmates in the discussion. What might the consequences be of having this information (e.g. health insurance coverage, privacy, etc.)?To understand this research, you must be familiar with some basic genetic terminology. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. dominant allele phenotype The possession of two different alleles of a particular gene is referred to as Reset Help A variation in a DNA sequence at one particular position is called a heterozygosity genotype recessive allele homozygosity single nucleotide polymorphism The appearance of the organism, its observable traits, are referred to as the A variant of a gene for which an individual must be homozygous in order for it to influence the appearance of the organism is a The set of alleles an organism has for a particular trait is the organism's Submit Request Answer
- Search the menus (Alt+/) 75% Normal text Calibri в IUA 11 + ... 1.| 2 | 3 | • 4.| 5 6 8 12. Although Laurlanthalasa, Princess of the Qualinesti elves, is known for riding into battle on a silver dragon, this is not her main form of transportation. She generally travels by way of griffon. Although the allele for a "crown" of feathers around the head is dominant, it is rarely found in the wild. This may be due to the fact that it makes the griffons stand out, thus making them less effective hunters and more visible to their natural enemies, evil chromatic dragons. This scarcity also makes them prized by elven royalty. Lauralanthalasa was given a breeding pair of bald griffons by an admirer who claims that they are both hybrids for the crowned gene. Create a Punnett Square to determine if Lauralanthalasa will have any chance using these two griffins to produce crowned offspring. Alleles (letters) and Phenotypes All Genotype and Phenotype Parent Punnett Square Possibilities Genotypes…Non- Mendelian patterm of inheritance. Activity 4: What's your blood type? Objective: Infer the unknown phenotypes of individuals on the basis of the known phenotypes of their family members Procedure: A. Given the blood types of the mother and the child, identify the possible blood type of the father. Mother's Blood type Father's Blood type Child's Blood type A B AB ABAn important application of DNA fingerprinting is relationship testing. Persons who are related genetically have some bands or peaks in common. The number they share depends on the closeness of their genetic relationship. For example, an offspring is expected to receive half of his or her minisatellites from one parent and the rest from the other. The diagram shown here schematically illustrates traditional DNA fingerprints of an offspring, mother, and two potential fathers. In paternity testing, the offspring’s DNA fingerprint is first compared with that of the mother. The bands that the offspring have in common with the mother are depicted in purple. The bands that are not similar between the offspring and the mother must have been inherited from the father. These bands are depicted in red. Which male could be the father?