Question: Hi, can someone help me with this question thanks in advance. Select one of the following genetic diseases that appear in the following list: galactosemia cystic fibrosis Down's Syndrome familial hypercholesterolemia muscle gystrophy Huntington's disease sickle cell anemia hemophilia Tay-Sachs disease describe a composition about how the selected condition is generated. Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks

Question: Hi, can someone help me with this question thanks in advance. Select one of the following genetic diseases that appear in the following list: galactosemia cystic fibrosis Down's Syndrome familial hypercholesterolemia muscle gystrophy Huntington's disease sickle cell anemia hemophilia Tay-Sachs disease describe a composition about how the selected condition is generated. Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks

Principles Of Pharmacology Med Assist

6th Edition

ISBN:9781337512442

Author:RICE

Publisher:RICE

Chapter22: Medications Used For Gastrointestinal System Disorders

Section: Chapter Questions

Problem 10RQ

See similar textbooks

Similar questions

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100 for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches? can someone correct my answers and show me how they got theres and do not use chegg
how do i expand this into 1000 words for a result section of a report The objective is to interpret the results of an RNA-Seq analysis to identify differentially expressed genes in breast cancer using figure 1. The data provided includes gene symbols, chromosome location, start and end points, strand, fold change, log2 fold change, p-value, and false discovery rate (FDR). The RNA-Seq analysis has identified several genes that are differentially expressed in breast cancer. These genes are located on various chromosomes and have varying levels of fold change, indicating the degree to which their expression levels differ between normal and cancerous cells. The gene with the highest fold change is EYA4, located on chromosome 6, with a fold change of 3604.4176. This indicates that the expression of this gene is over 3600 times higher in cancer cells compared to normal cells. The log2 fold change is 11.81555, which is a measure of the magnitude of the difference in gene expression. The…
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
why my answer is incorret？what is function of A？
PLEASE FILL UP THE FOLLOWING BRO I WILL UPVOTE. DO NOT COPY THE SAME ANSWER ANYMORE. AND MAKE THE ANSWERS LONG
134 LABORATORY Size of the Cell U22T RAJUBAV RO OJA Shape of the Nucleus 916 91032 Degree of Chromatin Condensation Presence or Absence of Nucleoli Cytoplasmic Staining Blood Cells Presence of Cytoplasmic Granules Cytologic/Histologie 18: or cellule Bone Marrow Cells of the develo eveloping cells noil Identi 010
Glycogen storage disease type VII or Tarui disease is a rare, autosomal recessive muscularglycogenosis characterized by exercise intolerance, rhabdomyolysis episodes, i.e., disintegration ofmuscle associated with excretion of myoglobin in the urine, and hemolytic anemia, i.e., breakdown ofcirculating erythrocytes with release of hemoglobin into plasma, generally revealed by laboratory tests.The molecular origin of this disease is a deficiency of muscle PFK-1 with a partial deficiency of theenzyme in erythrocytes. Important characterization of the metabolic imbalances associated with thisdisease has been obtained by genetically generating mice with muscle PFK-1deficiency. The histogram diagrams below contrast levels of three glycolytic intermediates in skeletal muscle tissue of wildtype (+/+) normal mice with that in PFK-1 deficient (-/-) mice during rest and exercise. Using thematerial discussed in the previous parts of this question, discuss why lactate concentrations in thePFK-1…
Please help me with this questions. I provided an example on how it has to be done. I don’t completely understand and is stuck. These questions are test cross questions but can not use Punnett squares to solve the problem. It’s using the trihybrid cross with forked line method. Please help me I try solving it multiple times and gets it wrong
How do I fill out the chi square analysis
hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
Please explain why D)[2,3,&4] is wrong and give me the correct answer
True or false? The most common form of Down's Syndrome results from a spontaneous, somatic, gene mutation.