Question 5 Listen When heat treated S strains were added to a R strain and the mixture injected into a mouse, the mouse died True False
Q: The rate of the reaction of glycogenn with inorganic phosphate, P₁, to form glucose-1-phosphate and…
A: For a chemical reaction: The rate law equation below describes the mathematical relation between the…
Q: This is the three-letter code for the amino acid that is the most geometrically constricted amino…
A: Amino Acids are the organic compounds that combine to form proteins, hence they are referred to as…
Q: You are told to analyze the purity of your product with TLC. Which of the following TLC plates would…
A: The working principle of thin-layer chromatography is the same as column chromatography. A small…
Q: Moira, a biochemistry major, wanted to explore the shapes a single-stranded DNA molecule can take.…
A: DNA is deoxy ribo nucleic acid which consists of two strands of nucleotides connected by hydrogen…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: The free energy change for the malate dehydrogenase reaction of the TCA cycle is ≈21.122…
Q: what metabolic pathways are more likely to be active during: a) fasting, b) overnight fast) and c)…
A: Intermediary metabolism, also known as metabolic pathways, is the intricate network of chemical…
Q: Genetics Question 8
A: The objective of the question is to identify the correct event that occurs during the prophase of…
Q: 6. Consider the heptapeptide DERHHKY. What is the overall charge of this peptide at pH 5 and pH 7.4?…
A: Amino acids are organic molecules that form the building blocks of proteins. They contain an amino…
Q: The hydrolysis of sucrose has the following data. Time (min) 0 30 60 90 130 180 [Sucrose] (M) 0.5011…
A: To determine the half-life of the reaction, first identify the order of the reaction. The order of…
Q: Question 7 Identify the functional groups in the following structures. HO 1. 12345 1. HO- 3. GAWNE…
A: There are various functional groups present in each organic molecule. A functional group is a group…
Q: Question 7 Listen a= albino A= Non Albino b=blond B=Dark Hair c=straight hair C=Curly Hair d-deaf D=…
A: The objective of this question is to calculate the probability of an offspring inheriting specific…
Q: A circular double-stranded DNA molecule contains 4700 base pairs. In solution the molecule is in a…
A: The objective of the question is to calculate the superhelix density of a circular double-stranded…
Q: bond (s) with the.. 7th and 9th amino acids in the sequence. 12th amino acid in the sequence only.…
A: In an alpha helix, each amino acid residue is hydrogen bonded to the amino acid residue four…
Q: 2.13 Calculate the reaction enthalpy, entropy, and free energy, AH°r, AS°r, and AGºr, for the…
A: Reaction thermodynamics is the energy things that occur during a chemical reaction together with a…
Q: Assuming I got 1, 2, and 3 right can you please help with 4?
A: The objective of this question is to determine which generation the phenotype of the F2…
Q: I JUST WANTED TO NOTE THAT OPTION C IS 100% WRONG AND YOU CAN ONLY CHOOSE ONE OF THE OTHER 4 OPTIONS…
A: The DNA double helix's structural characteristics and interaction sites are described by the…
Q: Choose the False statement regarding mechanism of protease? 1. Cysteine proteases perform covalent…
A: Proteases are enzymes that cleave peptide bounds in proteins. Serine protease, cysteine protease,…
Q: Draw A mixed triacylglycerol that contains one saturated 8 - carbon fatty acid chain and two 6 -…
A: Triacylglycerols, or triglycerides, are fats found in living things, storing lots of energy. They're…
Q: Which factor contributes to the selectivity pore of the potassium channel from S. lividans? O…
A: S lividans stands for Streptomyces lividans. It is a gram positive & filamentous bacterium that…
Q: Genetics Question 12
A: The objective of the question is to identify the stage of cell division during which crossing over…
Q: Write out each of the eight chemical reactions of the citric acid cycle. Draw the structures of the…
A: Citric acid cycle is also called as tricarboxylic acid cycle or Krebs cycle. This is the second…
Q: Question 9 Listen Two hamsters with black, short hair mate. They have the following offspring 18…
A: The objective of the question is to determine the genotypes of the parent hamsters based on the…
Q: The protein catalase catalyzes the reaction 2 H,O,(aq) — 2 H₂O(1) + O₂(g) S and has a…
A: Reaction: 2H₂O₂(aq) → 2H2O(l) + O2(g)Km = 25 mMTurnover number Kcat = 4.0 × 107s–1Total enzyme…
Q: Genetics 8 Q4
A: The question is asking whether the process of meiosis, which is the division of a germ cell…
Q: Question 1: The standard reduction potential for the the cytochrome c Fe3+/Fe2+ redox couple and for…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Prepare a schematic diagram and present it as though it were a Figure in a publication (scientific…
A: Spiperone is an antagonist of D2 dopamine receptors. Because of this radiolabelled spiperone ( 3H…
Q: Genetics Q6
A: The objective of this question is to identify and explain two differences between the lagging strand…
Q: List 4 major types of inhibition modes and clearly indicate the effect on Vmax and KM for each mode?
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Genetics 8 Q7
A: The objective of the question is to understand the possible outcomes of non-disjunction in a female…
Q: Do Km and Vmax get affected by available enzyme concentration? Explain.
A: Enzymes are proteins that catalyse biochemical reactions. Michaelis Menten postulated that free…
Q: Question 5 Listen In cats, Short Hair (S) is dominant to long hair, Black fur (C) is dominant to…
A: The objective of this question is to determine the probability of a specific genetic outcome based…
Q: A) H H₂N-C-C <=0 CH2 OH ОН н D) H2N-C-C <=0 CH2 OH HO CH3 B) H₂N-C H3C-CH CH2 CH3 0= OH E) H2N-c-c С…
A: Amino acids are simply an alpha-carbon bonded to 4 different groups. The 4 groups are;an alpha-amino…
Q: Why is the NAD+/NADH pairing so effective in biochemical redox reactions? A The reactions occur…
A: NAD+ /NADH pairing means the interconversion between nicotinamide adenine dinucleotide (NAD+) and…
Q: 2. What is a checkpoint? Give an example and say what happens at that checkpoint.
A: The objective of this question is to understand the concept of a checkpoint in the context of…
Q: 1. Explain what happens in the following stages A. S phase: B. Prophase: C. Anaphase: D.…
A: The question is asking for a detailed explanation of what happens during the S phase, Prophase,…
Q: In an a helix, how does bonding occur between the amino acids in the polypeptide chain? Match the…
A: An amino acid is a biomolecule made up of a hydrogen atom, an amino group, a carboxyl group and a…
Q: Was it appropriate to use human serum protein as the standard when you were analyzing egg proteins…
A: When analyzing egg proteins in unknown samples, using human serum protein as a standard may not be…
Q: Q5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in…
A: The objective of the first question is to identify a single basepair DNA change that would lead to a…
Q: Draw a parallel beta sheet and an antiparallel beta sheet (three strands each). Show the hydrogen…
A: The secondary structure of protein refers to the local folded structure that forms within in…
Q: Mark any/all that apply to uncompetitive inhibition: Group of answer choices: None of these is…
A: The enzyme inhibition which is also known as anti-competitive inhibition is characterised by change…
Q: Onlyqno3 solve. I. Given a polypeptide below, answer the following questions:…
A: Proteins are polymers of amino acid residues linked together via peptide bonds and folded into a…
Q: 22. For the process, A B, Keq is 0.02 at 37°C. For the process, BC, Keq 1000 at 37°C. A. Determine…
A: The objective of the question is to determine the equilibrium constant for the overall process A…
Q: Create a concept map to demonstrate the relationships between carbohydrate, protein and lipid…
A: Catabolism is the breakdown of large molecules into smaller ones. This is often undertaken to…
Q: You are sprinting around a track and at about the 200 meter mark you start to feel a burning…
A: Fermentation is defined as an anaerobic process in which even during absence of oxygen, energy can…
Q: Genetics Question 16
A: The question is asking whether the number of chromosomes in the daughter cells produced at the end…
Q: Draw the following amino acids linked by peptide bonds: a. aspartate b. lysine c. cysteine d.…
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They are monomers or…
Q: If the Gibbs free energy change for the reaction; Succinate + FAD Fumarate + FADH2 is -40KJ/mol at…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Tube # 2 3 4 6 5. THE EFFECT OF TEMPERATURE Temp. Abs. 0°C N/A 0°C 25°C 25°C 37°C 37°C 70°C 70°C 10…
A: Changes in temperature can affect the enzyme in different ways. When the temperature of the system…
Q: Use the appropriate equation to calculate the free energy change for the movement of Nat into the…
A: The Nernst equation, named after Walther Nernst, is a powerful tool in electrochemistry that relates…
Q: sickle cell anemia
A: Sickle cell anemia (SCA) is a genetic disorder identified by abnormal red blood cells. Genetic…
Question 5
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- QUESTION 17 OL NEere interested in generating a PCR amplicon including the bracketed sequence below. Which of the following sequences would be canen hybridizing (annealing) with the target AND would also serve to generate a copy of the bracketed region of interest? 5'-AATCGT[AGCAGCAGCAGTGGCT]A AGCT-3 3' -TTAGCA[TC GTC GTC GTC ACC G A] TTCG A - 5' 3-TTAGC-S S-AATCG-3 OSAAGCT-3 5-AGCTT-3 5-GCTAA-3 5-TCGAA-3 QUESTION 18 Vhich of the following is/are true regarding the enzvme PRIMASE? Save and Submit to save and submit. Click Save All Answers to save all answers.Question 4 "In this mutation, the AGC is transcribed into UAG. " O missense mutation O nonsense mutation O silent mutation O frameshift mutationQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- QUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O XgalQuestion 3 Bacteria defend against phages by Natural selection favors mutation can not be recognized by virus. O all of these except DNA replication O restriction enzymes CRISPR-Cas system O DNA replicationQuestion 19 A transversion mutation would be replacing T by: A either A or G BU (c) T D) c
- QUESTION 26 3.0 The creation of knockout (or knockin) mice involves all but one of the following O A. recombination between the vector and the chromosome O B. a drug selection marker carried on the vector O C. Introduction of the knockout/knockin gene by microinjection into a fertilized oocyte O D. growth of stem cells in culture O E. mating of mice in the first generation to one another to obtain a purebred population. QUESTION 27 3.0 A restriction fragment length polymorphism (RFLP) can result from: O A. A base change that results in the loss of a restriction site O B. Deletion or insertion of DNA within a restriction fragment O C.A change in hybridization stringency O D.A base change that creates a new restriction site O E. C. only O F. A., B., and D.QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive sulfur (35S) were used, demonstrated that Oa. DNA labeled with 32P is transferred from the bacteriophage to the virus O b.DNA may be the hereditary material, although bacteriophages transfer both DNA and proteins into their hosts Oc. proteins labeled with 35S become deactivated and unable to be transferred O d. DNA labeled with 35S and proteins labeled with 32P can be traced over the course of an experiment O e. bacteriophages transfer their DNA, not their coat proteins, into their hosts QUESTION 15 Which of the following makes its own food using energy and simple raw materials it obtains from nonbiological sources? O a. Cell O b. Producer O C. Protist O d. Consumer O e. Nutrient QUESTION 16 A salt will dissolve in water to form O a bases O b.acids O c. buffers O d. jons other than H* and OH O e.only hydrogen and oxygen bonds QUESTION 17 The solvent, cohesive, and temperature…Question 28 Imagine that vou are working in a lab studying the SARS-COV-2 virus and you are trying to do an Avery-McLeod-McCarty type experiment to determine the genetic material of this virus. You know that if you transduce a mixture of macromolecules from viral isolates (taken from buman nas swabsinto human cultured cells, new infectious viral particles are made. You perform three experiments: 1. You treat the mixture with protease, then observe synthesis of viral particles. 2. You treat the mixture with RNase and observe no synthesis of viral particles 3 You treat the mixture with DNase and observe synthesis of viral particles. How do you interpret these results? The SARS-CoV-2 virus uses RNA as its genetic material. There was likely an error in the experiment because DNase treatment should have had the opposite result. II. II. The SARS-CoV-2 virus uses both proteins and DNA as its genetic material. Iy Avery, McLeod and McCarty tried this with SARS-CoV-2 and obtained different…
- Quèstion 34 Enzyme that joins the DNA fragments O Recombinant DNA Technology O Restriction enzymes O Ligase O Palindromic sequencesQuestion 28 Binding of transcription activator protein O Gene is switched ON O Gene is switched OFF O Does NOT affect the gene expressionQuestion 4 1 pts Original DNA strand: ATT GAG CC Mutated DNA strand: ATT GAG CT What type of mutation does the example above demonstrate? O Substitution O The example above does not demonstrate any mutation at all. Deletion O There is not enough information to determine which type of mutation is demonstrated. O Insertion