18 Question 18ListenYou have the following DNA sequence5'ACCTGTGCAATATACGGCCAT 3'If the A in bold is mutated into a T, what will happen to the protein that would be made from mRNAtranscribed from the DNA?The chain would be the same length, but more than one amino acid would bedifferent from the original sequenceThe amino chain would be longer than the amino acid chain of the originalsequenceThe amino acid sequence would not change at all from the original sequenceOne amino acid would change, the rest would stay the same relative to theoriginal sequenceThe amino chain would be shorter than the amino acid chain of the originalsequence

DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…

Answered: Question 18 Listen You have the…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 17 What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3 A 5'-UAGUGACAGUUGCGAU-3' B 5-TAGCGTTGACAGTGATA-3 5'-ATCACTGTCAACGCTA-3 D 5'-TAGTGACAGTTGCGAT-3'
Question 5 Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome O repetitive DNA related to transposable elements and related sequences (L1 sequences and Alu elements) O repetitive DNA unrelated to transposable elements (simple sequence and large-segment duplications O unique noncoding DNA O introns O exons O regulatory sequences
QUESTION 19 A mutation inserts one nucleotide pair in the center of the open reading frame of a gene. Which of the following outcomes do you expect after translation of this gene's MRNA? O A. a protein in which one amino acid is changed O B. a protein in which three amino acids are changed O C. a protein in which most amino acids after the site of the insertion are changed O D. a protein in which two amino acids are changed O E. no protein at all QUESTION 20 An alpha helix is a: O A. secondary structure found in proteins. O B. right-handed twist found in double-stranded DNA. O C. globular structure found in proteins. O D. post-translational modification of certain proteins. O E. helical region found in functional tRNAs. QUESTION 21 The aminoacyl-tRNA synthetase enzymes are responsible for: O A. matching each TRNA with the appropriate mRNA codon. O B. catalyzing the enzymatic step of peptide bond formation during translation. O C. synthesizing TRNA molecules in the nucleus from tRNA…
QUESTION 22 If polynucleotide phosphorylase (PNP) synthesizes random RNA when given a 50-50 mixture of G and A substrates, and this RNA is used to program an in vitro (cell free) translation system, what amino acids would be incorporated? Second letter G UUU UCU) UCC UCA UCG UAU UAC Tyr UGU UGC. Phe UUC U UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G UUGLEU CAU His CUU CUC CUA CUG CCU CC CCA CCG CGU CGC Arg U CAC CAA Leu Pro CGA CAGJGin CGG AUU ACU ACC ACA AAC FAsn AAA AAU Asn AGU AUC le A AUA AGC Ser Thr AAG Lys AGA GAUASP AUG Met ACG JArg AGG G GUU GCU) GACA GAA Glu GAGJ GGU] GGC GGA GGG GUC G GUA GCC Ala GCA Val Gly GUG GCG First letter DUAG Third letter
Question 25 If one DNA segment has the following base composition, 5-CAGTTAGTCA-3', which of the following sequences is complementary? A 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5' 3-TGACTAAСTG-5 D 5-TGACTAACTG-3'
QUESTION 4 The following diagram represents double-stranded DNA that is part of the RNA-coding sequence of a transcription unit. A e C B TGT ACT GCA AGC AAC ACA TGA CGT TCG TTG The sequence of the RNA product of transcription is 5'-UGU ACU GCA AGC AAC-3'. Which strand is the non-template strand, the strand on the top or on the bottom? In the sequence above, which arrow is pointing to the 5' end of the top strand (a or b)?
QUESTION 16 CRISPR in nature evolved as a "bacterial immune system" or "genetic vaccine" to target infecting viruses. What aspect of the system can we now manipulate so that you can promote *more* transcription of a desired gene? O A nuclease deficient cas9 a single amino acid mutation in Cas9 o edit the PAM sequence supply a DNA template with the cas9/guide RNA use a special guide RNA
Question 4 "In this mutation, the AGC is transcribed into UAG. " O missense mutation O nonsense mutation O silent mutation O frameshift mutation
Question 11 Given this MRNA strand: 3' - AUGAGGAAGGUA - 5'; what are the components of the polypeptide? First Position Third Position (3' end) (5' end) U A G UGU Cys UUU Phe UUC Phe UCU Ser UCC Ser UCA Ser UAU Tyr UAC Tyr UAA Stop UAG Stop |U UGC Cys UUA Leu UUG Leu UGA Stop |A UGG Trp U G CGU Arg CGC Arg CGA Arg UCG Ser CAU His САС His CAA Gln CAG Gln CUU Leu CCU Pro U ССС Pro CỤC Leu CỦA Leu CUG Leu CCA Pro A CCG Pro CGG Arg G U AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu AUU Ile ACU Thr АСС Thr ACA Thr ACG Thr AGU Ser AUC Ile A AUA Ile AGC Ser AGA Arg A AUG Met* AGG Arg G GUU Val GGU Gly GCU Ala GCC Ala GCA Ala GCG Ala U GGC Gly GÚC Val G GUA Val GGA Gly |A GUG Val GGG Gly G
QUESTION 23 Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR QUESTION 24 Mutagens are useful in biotechnology research for Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answe
QUESTION 10 The steady state level of a MRNA for a gene is affected by the following mechanism(s) O Rate of RNA synthesis O The levels of nonsense suppressing TRNAS Rates of RNA synthesis and degradation Rate of RNA degradation O Frequency of AUG codons
QUESTION 22 Choose all the experiment(s) from the list below that demonstrated that RNA is involved in a transfer step between DNA and protein. O A. pulse chase experiments using radioactive deoxyribose O B. Brenner and Crick's characterization of frameshift suppressor mutations O C. analysis of the burst of RNA synthesis after bacteriophage infection of E. coli O D. pulse chase experiments using radioactive uracil bases O E. the Meselson Stahl experiment

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS