Question 1 Listen You have 10 copies of a DNA sequence. You do 29 rounds of DNA amplification using the PCR reactions. How many copies of the DNA sequence do you have now? 58 5368709120 841 1029
Q: What is the correct chromosomal condition at prometaphase of mitosis? A B C D E
A: The objective of the question is to identify the correct chromosomal condition during the…
Q: What thoughts do you have on stigma & bias related to opioids, history of opioids, cause of…
A: The opioid crisis is a significant public health issue in the United States, with overdose deaths…
Q: der these chemical species by increasing pH of an 0.1 M aqueous solution of each. That is, imagine…
A: Step 1: Step 2: I have given detailed step by step solution approach to solve this problem go…
Q: Part 3 - Label the structures indicated in the transverse abdominal section shown. 2. 3. 1. 4. 5. 6.…
A: Here's a brief overview of each of the anatomical structuresVertebra:Vertebrae are the individual…
Q: Instrucciones. Realiza un organizador grafico de red trofica, señalando el tipo de alimentación…
A: Hope that helps! Please, if you know the translation of those things in spanish, please translate…
Q: Please explain
A: Lane A:* DNA sample: Human genomic DNA* Enzyme: EcoRI (5' G^AATTC 3')Lane B:* DNA sample:…
Q: Let’s suppose you were interested in developing drugs to prevent epigenetic changes that may…
A: Genes are basic physical and functional unit of heredity. It is a part of DNA that has instruction…
Q: Question 22 (iviariuatury/ When E. coli is grown with tryptophan, the transcription of tryptophan…
A: In the case of prokaryotic cells gene expression is regulated by the operon system in which multiple…
Q: 3 Compound A is an optically active mixed triglyceride, for which the following apply: a) contains…
A: ### Triglycerides and Fatty AcidsTriglycerides are esters derived from glycerol and three fatty acid…
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: Approach to solving the question:To determine the expected numbers, I applied Mendelian genetics…
Q: What is suspected when the hematocrit has decreased by 4% and the total bilirubin level is increased…
A: The objective of the question is to identify the possible medical condition based on the given…
Q: E. coli strain BW25113 can grow on (D) Arg as the sole carbon source. A scientist working with you…
A: Obtain the genomic from the mice cells that encode for the protease of interest.Fragment the…
Q: What innovations to the items Rice and staple products, Fish and marine products, Fruits and…
A: In response to the challenges posed by natural calamities like typhoons and earthquakes, the…
Q: Which of the following is NOT an adaptation among plants to increase access to nitrogen?…
A: Mutualistic association with fungi that convert atmospheric nitrogen into a biologically available…
Q: GQ12
A: The objective of this question is to understand the impact of silent mutations on the structure and…
Q: answer only question g
A: Step 1:The anticodon sequence will be…
Q: D Question 2 Name the specific tissue type that would serve as the "binding material" between a…
A: The objective of the question is to identify the type of tissue that acts as a 'binding material'…
Q: Briefly describe the overall message of figure 1C
A: Figure 1C presents a detailed depiction of the gene network associated with the gastrointestinal…
Q: GQ12
A: The correct answer is translation. Explanation:The process of forming a polypeptide chain from mRNA…
Q: 11. Using the information in the introduction on mutations and your knowledge of proteins, develop a…
A: The gene provides instructions for making a protein called the melanocortin receptor that is :-…
Q: Choose all items that regulate the transcription of mRNAs.Group of answer choices A. Transcription…
A: The objective of the question is to identify the elements that regulate the transcription of mRNAs.
Q: Facilitated diffusion and active transport are two different mechanisms that the cells use to…
A: Answer well explained above
Q: 41. In Aristotle’s scala naturae, the entoma (insects, chelicerates, and other non-crustacean…
A: The question is asking about the classification of entoma (insects, chelicerates, and other…
Q: Sugar fermentation (Mannitol): 1. Explain the incubation conditions 2. Explain the reagents being…
A: Sugar fermentation, such as Mannitol fermentation, is a process where microorganisms, such as…
Q: What group of tests can be done to diagnose chronic myelocytic leukemia? Question 6 options:…
A: The objective of the question is to identify the correct group of tests that can be used to diagnose…
Q: Explain why people with type AB+ blood can receive blood transfusions from any blood type, but…
A: People with type AB+ blood are considered universal recipients because they have both A and B…
Q: Question 18 When a patient is said to have "second-degree burns," this indicates that the patient…
A: The question is asking about the characteristics of second-degree burns. It's important to note that…
Q: Define about Whole-Exome Sequencing ?
A: Whole- exome sequencing( WES) is a genomic approach for sequencing all of the protein- encoding…
Q: 1- St. Aurelius Augustine, in his theodicy attempting to reconcile freedom and determinism,…
A: The question is asking about the theological implications of St. Aurelius Augustine's theodicy,…
Q: none of the above Question 13 Which combination of organelles has never been found in an animal…
A: The combination of organelles that are not found in an animal cell is *option-2: Mitrochondria ,…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…
Q: For the VWA locus, Sophie has two alleles, 16 & 18. She inherited the allele with 16 copies from…
A: Answer well explained above
Q: The triplet UGA in mRNA causes: Choose ome a mutation in a protein translation to stop…
A: The question is asking about the role of the triplet UGA in mRNA during protein synthesis. mRNA, or…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: What topics about opioids would you try to change to address thenegative impacts of the opioid…
A: Prescribing Practices: This point highlights the need to educate healthcare professionals about…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx You will need to access the journal website…
A: A randomized experiment was conducted to investigate the effects of early physical exercise therapy…
Q: What is the difference between ventilation and respiration?
A: Ventilation:Ventilation is the process of moving air in and out of the lungs. It involves the…
Q: Note there are no cells on this panel that have a double dose (homozygous) of the K antigen. Which…
A: The K+k- phenotype refers to the presence of K antigen and absence of k antigen on the red blood…
Q: LH RH LF (B) LH LF Walk RHI RF Trot LH LF RH RF LH RF HI Flexors Extensors -Flexion: -Extension- (C)…
A: Galloping model is mainly wind induced vibration that mainly occurs in overhead transmission lines.…
Q: Describe how opioids act at the synaptic cleft to block nerve transmission and prevent pain…
A: Opioids are a class of drugs that are commonly used for pain relief.Their mechanism of action…
Q: 6. Questions: Round 2 - Male parental involvement 。 Did the average number of matings per type vary…
A: **Method for addressing the query:**1. Comprehending the setup of the experiment: Start by carefully…
Q: Which subtype of lung cancer is most directly linked with cigarette smoking? A) Adenocarcinoma B)…
A: Answer well explained above
Q: Answer the following questions about CRISPR below: A.What is a PAM sequence? B.How does the…
A: A. PAM Sequence:A PAM sequence, or Protospacer Adjacent Motif, is a specific DNA sequence that is…
Q: How did the observable colonies on each agar plate differ in size, color, and morphology for each of…
A: Size:The size of microbial colonies can vary widely depending on several factors:Growth rate: Some…
Q: There is a new virus named HANDF that is infecting Cows in the USA. This is a novel virus and the…
A: You also need to consider the following: Positive/Negative controls: Include appropriate controls to…
Q: Theophrastus of Lesbos, Aristotle’s successor as head of the Lyceum, improved upon Aristotle’s…
A: Monocotyledons (monocots) are flowering plants with a single embryonic seed leaf (cotyledon). They…
Q: 3:08 1 Back ions amino acids Pulse Question 5 An enzyme works by adding energy to a reaction…
A: Enzymes are biological catalysts that speed up chemical reactions by lowering the activation energy…
Q: Myeloperoxidase staining activity decreases as cells mature. Question 1 options: True…
A: The question is asking whether the activity of myeloperoxidase, an enzyme found in neutrophils and…
Q: (please type answer fast).
A: The objective of this question is to calculate the pH of a buffer solution after the addition of a…
Genetics Q1
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question 5 Review DNA sequencing and cloning tools. Which of these is not used to make a recombinant DNA? O restriction enzymes to create sticky ends of a plasmid O fragment from a different DNA cut by the same restriction enzyme O DNA ligase seals the recombinant DNA O denaturationQUESTION 5 Match the vocabulary word with the proper definition: enzyme that joins two pieces of DNA ✓ first human protein to be produced by genetic engineering 00000 ✓ process that makes many copies of a gene or other DNA segment the process of isolating and making copies of a gene ✓ the process of placing recombinant DNA into a living cell circular DNA that is not part of a chromosome V genetically modified plants changing an organism by transforming with recombinant DNA DNA ligase II. recombinant DNA III. transgenic crop IV. polymerase chain reaction V. gene cloning VI. genetic engineering VII. transformation VIII. plasmid IX. biotechnology X. insulin the use of technology to change the genetic makeup of living things for human purposes made by joining DNA from two differentQuestion 7 Review DNA sequencing and cloning tools. The direct manipulation of genes is called genetic engineering DNA sequencing nucleic acid hybridization gene cloning O recombination DNA
- QUESTION 7 Primers are needed to start a PCR reaction True O False QUESTION 8 Restriction enzymes specifically recognize and cut short sequences of DNA called introns. O exons. O sticky ends. restriction sites. QUESTION 9 The DNA profiles used as evidence in a murder trial look something like supermarket bar codes. The pattern of bars in a DNA profile shows O the order of genes along particular chromosomes O the order of bases in a particular gene O the presence of differently-sized fragments of DNA O the presence of dominant or recessive alleles for particular traits O the number of chromosomes and whether any are damagedQuestion 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiationQuestion 16 Why can't SNPS be detected by PCR and Gel Electrophoresis? O Because Gel Electrophoresis detects size differences in DNA and SNPS do not change the size of the DNA strand. O Because SNPS cause deletions so large that they are beyond the limits of this technique to detect. O Because SNPS affect proteins and PCR only works on DNA. O Because SNPS are too complicated to detect with this technology.
- Question 32 Enzyme that combines the 2 DNA fragments from different organisms Recombinant DNA Technology Restriction enzymes O Ligase O Palindromic sequencesQuestion 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'Instructure.com/courses/47420/quizzes/225324/take missour Question 2. It is your first week working in the lab but unfortunately you program the PCR machine incorrectly and some of your PCR experiments do not work as expected. For each of the following scenarios, state at which step the PCR went wrong, what was wrong and what would have happened. Cycles Which step is incorrect? Is the temp too high or too low? Experiment of What happened? PCR Step 1 94 °C Step 94°C V [ Select ] [ Select ] [ Select ] a step 2 Step 3 72 °C step 3 step 1 Step 1 30 °C Step 2 60 °C [ Select ) [ Select ] [ Select ] Step 3 72 °C Step 1 94 °C [ Select] Step 2 22°C [ Select ] [ Select ] Step 3 72 °C 8 A átv
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…Joe is heterozygous for a dominant genetic disease. His wife, Jenny does not have the disease. They have 5 children of which 2 (Jim and Jan) have the disease and 3 (Jose, Jerry and Julie) do not. DNA from each individual is isolated and analyzed by PCR an gel electrophoresis. 3 variable markers are studied. The results for each marker are shown here. The numbers to the left of each gel represent size in hundreds of bases Jim Jose Marker 1 Marker 2 Marker 1 Jenny Joe Marker 3 Jan Jerry Julie Jim Jose Marker 2 Jenny Joe Jan Jerry Julie Jim Jose Marker 3 Jenny Joe Based on these results, which marker is most likely associated with the condition? Jan Jerry JulieQUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…